ID: 968001031

View in Genome Browser
Species Human (GRCh38)
Location 3:195206944-195206966
Sequence AAATATCCACAGAAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 410}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968001031_968001041 25 Left 968001031 3:195206944-195206966 CCTCTCTCCTTCTGTGGATATTT 0: 1
1: 0
2: 1
3: 33
4: 410
Right 968001041 3:195206992-195207014 GGGGGAAAAAAAAAGGCCCACGG 0: 1
1: 0
2: 6
3: 74
4: 570
968001031_968001038 7 Left 968001031 3:195206944-195206966 CCTCTCTCCTTCTGTGGATATTT 0: 1
1: 0
2: 1
3: 33
4: 410
Right 968001038 3:195206974-195206996 TCCATAATAAAAGGTGGAGGGGG 0: 1
1: 0
2: 1
3: 38
4: 322
968001031_968001037 6 Left 968001031 3:195206944-195206966 CCTCTCTCCTTCTGTGGATATTT 0: 1
1: 0
2: 1
3: 33
4: 410
Right 968001037 3:195206973-195206995 TTCCATAATAAAAGGTGGAGGGG 0: 1
1: 1
2: 4
3: 20
4: 285
968001031_968001035 4 Left 968001031 3:195206944-195206966 CCTCTCTCCTTCTGTGGATATTT 0: 1
1: 0
2: 1
3: 33
4: 410
Right 968001035 3:195206971-195206993 TTTTCCATAATAAAAGGTGGAGG 0: 1
1: 0
2: 7
3: 48
4: 396
968001031_968001042 28 Left 968001031 3:195206944-195206966 CCTCTCTCCTTCTGTGGATATTT 0: 1
1: 0
2: 1
3: 33
4: 410
Right 968001042 3:195206995-195207017 GGAAAAAAAAAGGCCCACGGAGG 0: 1
1: 0
2: 2
3: 44
4: 349
968001031_968001034 1 Left 968001031 3:195206944-195206966 CCTCTCTCCTTCTGTGGATATTT 0: 1
1: 0
2: 1
3: 33
4: 410
Right 968001034 3:195206968-195206990 AAATTTTCCATAATAAAAGGTGG 0: 1
1: 1
2: 9
3: 85
4: 581
968001031_968001033 -2 Left 968001031 3:195206944-195206966 CCTCTCTCCTTCTGTGGATATTT 0: 1
1: 0
2: 1
3: 33
4: 410
Right 968001033 3:195206965-195206987 TTGAAATTTTCCATAATAAAAGG 0: 1
1: 17
2: 46
3: 132
4: 714
968001031_968001036 5 Left 968001031 3:195206944-195206966 CCTCTCTCCTTCTGTGGATATTT 0: 1
1: 0
2: 1
3: 33
4: 410
Right 968001036 3:195206972-195206994 TTTCCATAATAAAAGGTGGAGGG 0: 1
1: 2
2: 3
3: 43
4: 393
968001031_968001040 18 Left 968001031 3:195206944-195206966 CCTCTCTCCTTCTGTGGATATTT 0: 1
1: 0
2: 1
3: 33
4: 410
Right 968001040 3:195206985-195207007 AGGTGGAGGGGGAAAAAAAAAGG 0: 1
1: 1
2: 13
3: 147
4: 1245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968001031 Original CRISPR AAATATCCACAGAAGGAGAG AGG (reversed) Intronic
901290048 1:8117035-8117057 AAATATTTACAGAAGGTCAGGGG + Intergenic
901739827 1:11334777-11334799 AACTGTGGACAGAAGGAGAGCGG + Intergenic
902727629 1:18347619-18347641 AGATCCCCACGGAAGGAGAGTGG - Intronic
903314546 1:22491516-22491538 AAAGGTCCACAGAAGGAGGTAGG + Exonic
904051222 1:27640168-27640190 TAACATCCCCAGAAGGTGAGAGG - Intergenic
904923475 1:34027582-34027604 AAATGTCCACAGAAGATGACTGG + Intronic
905585685 1:39115798-39115820 AATTGTCCACAGAAAGGGAGTGG + Intronic
905751917 1:40472720-40472742 AAATACCCACAGGTGTAGAGGGG + Intergenic
906604784 1:47160367-47160389 AAATATAAACCCAAGGAGAGAGG - Intergenic
908516384 1:64897125-64897147 AAATAGCAAAAGAAGGAAAGTGG + Intronic
908849892 1:68365066-68365088 TCACATCCAGAGAAGGAGAGAGG - Intergenic
909173130 1:72319803-72319825 AAATAGCCACACATGGCGAGTGG + Intergenic
909357088 1:74722165-74722187 GAATATCCAGAGAAAAAGAGAGG + Intronic
910713898 1:90209379-90209401 AAATATGTAAATAAGGAGAGAGG - Intergenic
910844552 1:91592783-91592805 AAACATCCACAGAAGATCAGTGG - Intergenic
911531017 1:99043119-99043141 AAATATCCACAGGTGTGGAGGGG + Intergenic
911700185 1:100943538-100943560 AAAGATCCAGATAGGGAGAGCGG - Intronic
911758077 1:101583541-101583563 AAAGTTGCCCAGAAGGAGAGAGG + Intergenic
912114660 1:106390498-106390520 ATATATCCTCAGAAGGACATAGG - Intergenic
912642578 1:111361431-111361453 AAATACCCACAGATGTGGAGGGG - Intergenic
913011275 1:114686276-114686298 ACAGATCCAGAGAAAGAGAGAGG - Intronic
913570430 1:120114503-120114525 AAGTTTCCAAAGAAGGATAGGGG - Intergenic
914291235 1:146275481-146275503 AAGTTTCCAAAGAAGGATAGGGG - Intergenic
914427008 1:147586758-147586780 AAATTTCTACAGGTGGAGAGGGG - Intronic
914552279 1:148726264-148726286 AAGTTTCCAAAGAAGGATAGGGG - Intergenic
914920164 1:151840934-151840956 AAATAACCACATAAATAGAGGGG - Intergenic
915242662 1:154534543-154534565 AACTATCCGCTGAAGGAGTGGGG + Intronic
916039072 1:160946917-160946939 AAATACCCACAGATGTGGAGGGG - Intronic
916323577 1:163533019-163533041 TAATGACCACAGAATGAGAGTGG + Intergenic
918133422 1:181648127-181648149 AAATCTCCACAGATTGAGAGGGG + Intronic
918465795 1:184820353-184820375 AAGTAGGCACAGAGGGAGAGTGG - Intronic
918765773 1:188481557-188481579 AAATATCAAAAGGAGAAGAGAGG - Intergenic
918823149 1:189285440-189285462 AAATATCCACATAAGGTTTGGGG + Intergenic
919596708 1:199573058-199573080 AAATATCGACAGAAATAGAGAGG + Intergenic
919899481 1:202033514-202033536 AAACAGCAACAAAAGGAGAGTGG + Intergenic
920873533 1:209813872-209813894 AAGTCTTCACAAAAGGAGAGGGG + Intergenic
921320392 1:213932855-213932877 AAAGATCCAAAGAAGGAGGATGG - Intergenic
922663601 1:227450596-227450618 AAGAGTCCACACAAGGAGAGAGG - Intergenic
923725937 1:236505489-236505511 AAATATCCACAGGTGTGGAGGGG + Intergenic
924829963 1:247582963-247582985 AAATACCCACAGATGTGGAGGGG + Intergenic
1063107093 10:3001919-3001941 AAAGAAACAGAGAAGGAGAGTGG + Intergenic
1063685593 10:8234517-8234539 AAGTTTACATAGAAGGAGAGAGG - Intergenic
1064134622 10:12740090-12740112 AAAGATTCACAGAAGGAAGGTGG - Intronic
1064187419 10:13174581-13174603 AAATATCCACAGGTGGCTAGTGG - Intronic
1064606377 10:17045219-17045241 CAATTTCCCCAGAAGGAAAGGGG - Intronic
1065294028 10:24257953-24257975 AGATGGCCACAGAAGCAGAGAGG + Intronic
1065571172 10:27072310-27072332 AAGAATCCACAGAAGGAGCTGGG - Intronic
1065967699 10:30782722-30782744 ACATTTCCAGAGAAAGAGAGAGG + Intergenic
1066196028 10:33100979-33101001 AAATATTCAGAAAAGCAGAGAGG - Intergenic
1068020568 10:51578127-51578149 AAATATCCAGAGAAGAAAATAGG - Intronic
1068312532 10:55296304-55296326 CAATCTCCAGGGAAGGAGAGGGG - Intronic
1068976948 10:63020517-63020539 AAGCATCCACAGGAAGAGAGAGG - Intergenic
1069725697 10:70576441-70576463 TAATACCCACAAAAAGAGAGAGG - Intergenic
1070183495 10:74037401-74037423 AAAGATCTACAGAAGCAGAAAGG - Intronic
1070226556 10:74514381-74514403 AAATATCTCCAGAAGGTGAAGGG - Intronic
1071435352 10:85643937-85643959 AAATATCACCAGACGGTGAGTGG + Intronic
1071932681 10:90490506-90490528 AAATAGCCAGAAAAGGAGACAGG + Intergenic
1072074772 10:91958747-91958769 CACTATCCACAGCAAGAGAGAGG - Intronic
1072316657 10:94210347-94210369 AAAGATCCTCAGAAGGAATGGGG - Intronic
1072363705 10:94687185-94687207 TAATCACCACAGAAGGAGAGTGG - Intronic
1072410433 10:95197209-95197231 AAATACCCACAGATGTGGAGGGG - Intronic
1072449806 10:95530903-95530925 AAACATCCACAGCTAGAGAGGGG + Intronic
1073731387 10:106292389-106292411 GAATATCCACAGATGGGCAGAGG + Intergenic
1074172496 10:110956467-110956489 CTATATCCAAAGAAGCAGAGTGG - Intronic
1074670509 10:115785125-115785147 ACATATCCACCGATGGAGAGGGG - Intronic
1074801583 10:117005547-117005569 AAAGAACCACAGAGGTAGAGCGG + Exonic
1075227103 10:120639550-120639572 AAGTATCCACTGCAGGACAGAGG + Intergenic
1075474272 10:122719801-122719823 AAAAAGGCATAGAAGGAGAGAGG - Intergenic
1076770659 10:132662389-132662411 AGATAGCCACAGCAGGTGAGTGG + Intronic
1077616171 11:3675700-3675722 AACTATCCACAGAAGGAAGAGGG - Exonic
1078832541 11:14991433-14991455 TAATATCCAGGGCAGGAGAGGGG + Intronic
1079491328 11:20991950-20991972 AAAGAACCAAAGAAGGAGAGGGG - Intronic
1079534086 11:21489974-21489996 AAATATCCACATCAGAAGAGAGG + Intronic
1081802289 11:45868270-45868292 AACTGTCCCCAGAAGGAGAGAGG + Intronic
1082753558 11:57048795-57048817 AGATTTCTACTGAAGGAGAGAGG - Intergenic
1083387076 11:62319085-62319107 GAAGATCCAGAGAAGGAGGGAGG + Intergenic
1084383748 11:68829339-68829361 AGAAAATCACAGAAGGAGAGGGG - Intronic
1084553039 11:69860160-69860182 AAATATACACACAAGGGGATGGG + Intergenic
1084775934 11:71375527-71375549 AAATTTGCCCAGAAGGAGAAAGG + Intergenic
1086410369 11:86538870-86538892 AAATGTCCAGGGAAGAAGAGGGG + Intronic
1086999515 11:93400454-93400476 AAACAGACACATAAGGAGAGAGG - Intronic
1087303245 11:96459730-96459752 AAAAATCCATTGAAGGAGAATGG + Intronic
1087544182 11:99563140-99563162 AAACATCTCCAGAAAGAGAGTGG + Intronic
1089982683 11:122785411-122785433 AGATGTCCAGAGAAGGAGAGTGG + Intronic
1090956204 11:131514901-131514923 ATATATACACATAAAGAGAGAGG + Intronic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1091181378 11:133607484-133607506 AAATAACAACAGAGAGAGAGAGG + Intergenic
1092539480 12:9412016-9412038 ATAAATACAAAGAAGGAGAGGGG + Intergenic
1092603892 12:10098478-10098500 AAAGTTACACAGAAGGAAAGTGG + Intronic
1094236638 12:28175636-28175658 AGAGATCCTCAGAAGGTGAGTGG - Intronic
1094775572 12:33723415-33723437 AAATTTACACAAAAGGTGAGAGG - Intergenic
1095958957 12:47821655-47821677 AGATTTCAACAGAAGGAGAAAGG - Intronic
1096506517 12:52097273-52097295 TAATATCCAGGGAAAGAGAGGGG - Intergenic
1097217136 12:57423058-57423080 AAATATTTGAAGAAGGAGAGGGG + Intronic
1097478103 12:60084314-60084336 AAATTTCCACAGGACGAGATAGG - Intergenic
1097481818 12:60136741-60136763 AAAAATCTACACTAGGAGAGAGG + Intergenic
1097562545 12:61225171-61225193 ACATACACACAGAAAGAGAGAGG - Intergenic
1098014164 12:66086830-66086852 AAATATCCACACAGAGACAGTGG + Intergenic
1098394107 12:70000272-70000294 AAGCATCCAGAGAAGGAGAGAGG - Intergenic
1100075356 12:90774499-90774521 AAATATTCTAAGTAGGAGAGTGG - Intergenic
1102401386 12:112632669-112632691 ACATGTCCCCTGAAGGAGAGGGG - Intronic
1102416900 12:112771246-112771268 AAACATGCACAGGAGTAGAGAGG + Intronic
1102849717 12:116229133-116229155 AAATATACACAAATGGTGAGGGG + Intronic
1103196774 12:119050799-119050821 AAATAGCCACAGATGGCTAGTGG - Intronic
1103602148 12:122061236-122061258 ACACATCCACAGAAACAGAGAGG + Exonic
1104063115 12:125284778-125284800 AAATATCCAGAGAAGTGGACAGG + Intronic
1104083321 12:125452097-125452119 AAATGCCCACAGAAGAAAAGAGG + Intronic
1104121697 12:125806076-125806098 AAATATTTACAGAATGAGTGAGG - Intergenic
1104387372 12:128362973-128362995 AAATATCAAAAGATGAAGAGAGG + Intronic
1104514105 12:129407920-129407942 AAATGACCACAGATGGACAGTGG + Intronic
1104514320 12:129410207-129410229 AAATGACCACAGAGGGACAGGGG + Intronic
1104563568 12:129860158-129860180 AAATGTCCACAGAGGCAGAGTGG - Intronic
1104704284 12:130931719-130931741 AAAGAACCAGAGAAGGAGTGAGG + Intergenic
1106421271 13:29588294-29588316 AAATATACACTGAAGTATAGAGG + Intronic
1106453640 13:29907929-29907951 AAATATCCAAATAAGGATGGAGG - Intergenic
1107548312 13:41454335-41454357 TAATAGCCAGGGAAGGAGAGGGG - Intergenic
1107598470 13:41988305-41988327 CCATAACCACAGAAGGAGAATGG + Intergenic
1107731603 13:43354785-43354807 AAAAACCCACAGAAGCAGAAAGG - Intronic
1107949640 13:45450507-45450529 AAATATTTACAGAAGGAGAGTGG + Intergenic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1109404792 13:61883404-61883426 AAATATGCACAGAAAAAGGGAGG + Intergenic
1109414437 13:62019860-62019882 ACATATACACAGAGAGAGAGTGG + Intergenic
1110009420 13:70313404-70313426 AAATTTACATAGAAGCAGAGGGG + Intergenic
1110343683 13:74421353-74421375 AAATATCCTGAGAGGCAGAGAGG + Intergenic
1110825000 13:79961457-79961479 AAATACCCACAGAAGAAGGCGGG + Intergenic
1111089306 13:83421994-83422016 AAATATGTACAGAAAGAGAGAGG + Intergenic
1112372040 13:98802632-98802654 AAATTTCCACTGAAGGAGGCTGG + Intronic
1113006622 13:105711172-105711194 AAATTTCCAAAGAATGGGAGTGG - Intergenic
1113554087 13:111217262-111217284 AAAAATCCACTAATGGAGAGTGG + Intronic
1114006625 14:18320438-18320460 AAATACCCACAGATGTGGAGGGG + Intergenic
1114332135 14:21647820-21647842 AAATATCCCCATAAGAAGACAGG + Intergenic
1114668547 14:24396725-24396747 AAATATCCCCATCAGCAGAGAGG + Intergenic
1114799555 14:25757868-25757890 AAATATGAAGAGAAGGTGAGAGG - Intergenic
1115490952 14:33957607-33957629 ATATATGAACAGAAGCAGAGAGG - Intronic
1115519592 14:34220169-34220191 ATATATACACAGAGTGAGAGGGG - Intronic
1116615984 14:47139896-47139918 ATATATACACATATGGAGAGAGG + Intronic
1116693893 14:48148025-48148047 AAAAATCACCAGAAGGAGATAGG - Intergenic
1117030263 14:51661620-51661642 AAATATCTCCAGCAGAAGAGTGG + Intronic
1117159521 14:52974933-52974955 AAAAAACAAGAGAAGGAGAGTGG - Intergenic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119724742 14:76915083-76915105 GAAAATCAAAAGAAGGAGAGAGG + Intergenic
1121025956 14:90616389-90616411 ACATATCCACAAAAGGGAAGAGG + Intronic
1121669468 14:95696815-95696837 AGATATGGACAGGAGGAGAGAGG + Intergenic
1123753770 15:23380422-23380444 AAATAAACAAAGAAAGAGAGAGG + Intergenic
1123757642 15:23409287-23409309 AAATATTCACAGAAGGCGGCTGG + Intergenic
1127059691 15:55169760-55169782 AAATATCCACTTCAGAAGAGTGG + Intergenic
1127964972 15:63916516-63916538 AAACATCCAGCGAAGGGGAGGGG - Intronic
1129494404 15:75964227-75964249 AAATAAACACAGAAGGAAAGGGG + Intronic
1131695671 15:94875532-94875554 AAATATCTATAGAGGCAGAGAGG + Intergenic
1133481065 16:6171173-6171195 ATATAGACAAAGAAGGAGAGAGG - Intronic
1133485975 16:6218757-6218779 AAATATCTGAAGAAGGAGACCGG - Intronic
1133540090 16:6742583-6742605 AAATATCTACAGTAGGTGAATGG + Intronic
1133562040 16:6959514-6959536 AAATGCACACAGAATGAGAGAGG - Intronic
1133992302 16:10717852-10717874 AAATATCCAGGGAGGGAGAGGGG - Intergenic
1134782105 16:16907457-16907479 AAAGAGAGACAGAAGGAGAGAGG - Intergenic
1135394482 16:22120797-22120819 AAATCTGCAGAGAAGGGGAGGGG + Intronic
1135603621 16:23804035-23804057 AAATCTGTAAAGAAGGAGAGAGG - Intergenic
1135651748 16:24212435-24212457 AAAAAAGCACAGGAGGAGAGAGG - Intronic
1136091724 16:27925576-27925598 AAAGATGCATAGCAGGAGAGAGG + Intronic
1136932550 16:34432307-34432329 ACACAGCCACAGAGGGAGAGAGG - Intergenic
1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG + Intergenic
1138092315 16:54185707-54185729 AAATCTCCAAAGACTGAGAGAGG - Intergenic
1139622160 16:68154289-68154311 AACTATACACAGAATGATAGAGG - Intronic
1140323991 16:73982242-73982264 AAACATCCACACAAGATGAGTGG + Intergenic
1141023449 16:80520405-80520427 GTACATCCACAGAAGGAGTGGGG + Intergenic
1141147605 16:81542731-81542753 AAATGTCCTCATAAGAAGAGAGG - Intronic
1141418612 16:83897141-83897163 ACATAGCCAGAGCAGGAGAGAGG + Intergenic
1141686597 16:85573923-85573945 AAATTCCCACACAAGGAGGGTGG - Intergenic
1142870031 17:2814101-2814123 AAATATTCACAGAAGAAAAGGGG + Intronic
1148344227 17:46892697-46892719 AAATATTTATTGAAGGAGAGAGG - Intergenic
1148682844 17:49484525-49484547 AAAGAACCAGAGAAGGAGAAAGG - Intergenic
1149515281 17:57276535-57276557 AAATATGCAGAGAAAGATAGAGG + Intronic
1149585911 17:57786591-57786613 AAAAATTGACAGAAGGACAGTGG + Intergenic
1149608466 17:57941598-57941620 AAACATCTACAAAAGTAGAGAGG - Intronic
1149709800 17:58730074-58730096 AAAAATTCACAGAAAAAGAGAGG - Intronic
1150620601 17:66804979-66805001 AAATAAGCACAAAAGGGGAGAGG - Exonic
1151596765 17:75082697-75082719 AAATGGACACAGAAGGAGACAGG - Intergenic
1151954018 17:77371830-77371852 AAATATCCAAAGCATGAGGGAGG + Intronic
1152016878 17:77756643-77756665 AAATATCCACTGTGGGTGAGGGG + Intergenic
1152253669 17:79225182-79225204 AACTTTCCAAAGAGGGAGAGAGG - Intronic
1203168191 17_GL000205v2_random:118720-118742 AAATTTACACTTAAGGAGAGTGG - Intergenic
1153340544 18:3969507-3969529 AGATATACACAGAAAGACAGTGG + Intronic
1154507169 18:15053035-15053057 AAAGAGCTAGAGAAGGAGAGAGG + Intergenic
1155543520 18:26889870-26889892 TAATATCCAGGGGAGGAGAGGGG + Intergenic
1158764617 18:60434610-60434632 AAATATCCTCACAAGAAGATGGG + Intergenic
1158957695 18:62556306-62556328 AGATTTCCACAGAGGGACAGAGG - Intronic
1159073267 18:63649402-63649424 ATATATAGAGAGAAGGAGAGAGG - Intronic
1159357240 18:67352010-67352032 AAATATCCACAAAATTAGATAGG - Intergenic
1160850987 19:1192350-1192372 AACAAACCACAGAAAGAGAGAGG - Intronic
1162177567 19:8842543-8842565 ACCTATCCCCAGAGGGAGAGAGG + Intronic
1165141698 19:33703673-33703695 AAATATTGTGAGAAGGAGAGGGG - Intronic
1166012282 19:39951336-39951358 AAGGATCCACAGTAGCAGAGAGG + Intergenic
1167740599 19:51322869-51322891 AGATACCCAGAGAAAGAGAGAGG - Intronic
1167915983 19:52740453-52740475 AAATATCCACAGGTGTGGAGTGG - Intergenic
1167958781 19:53089772-53089794 AGATATGTACAGAATGAGAGAGG - Intronic
1167997912 19:53421452-53421474 AAACATCCACAGGTGTAGAGGGG + Intronic
1168581274 19:57557665-57557687 AAATACCCACAGGTGTAGAGGGG + Intronic
1168678685 19:58297778-58297800 ATATATCCAGGGAAGGAGAATGG - Exonic
925574017 2:5341435-5341457 AAATATCCTCATAAGAAGATGGG + Intergenic
925796707 2:7553518-7553540 AAATTCCCTCAGAAGGAAAGTGG + Intergenic
927408120 2:22795590-22795612 GAAACTTCACAGAAGGAGAGGGG - Intergenic
927764802 2:25796817-25796839 AAATAGCCACATGAGGATAGTGG - Intronic
928027615 2:27752877-27752899 CCACACCCACAGAAGGAGAGGGG + Intergenic
928947365 2:36783491-36783513 ATAGATCCACGGTAGGAGAGAGG - Intronic
930798928 2:55421959-55421981 AAATACAGACAGAAGGAGAGTGG + Intergenic
931084954 2:58819582-58819604 AAAATTTAACAGAAGGAGAGAGG - Intergenic
932971513 2:76548926-76548948 AAATGTCCACAGTTGGAGACAGG + Intergenic
933273642 2:80260537-80260559 AAATAACCAAATAAGAAGAGAGG - Intronic
934104944 2:88686918-88686940 AAATATCCCCATGAGGGGAGGGG + Intergenic
935854615 2:107260473-107260495 AAATAGCTACAGAAGGAAGGTGG + Intergenic
936816084 2:116462786-116462808 AAATATGCCCAAAAGGAGAATGG + Intergenic
937795352 2:126011356-126011378 AAACATCTACATAACGAGAGTGG + Intergenic
938074713 2:128325635-128325657 AAATTCACACAGAAGTAGAGAGG + Intergenic
939287499 2:140152315-140152337 ATATGTACATAGAAGGAGAGGGG - Intergenic
940873558 2:158880045-158880067 TAATATCCAGTGAAGGAGAGGGG + Intergenic
941533851 2:166698278-166698300 TAATATCCAGGGAGGGAGAGGGG - Intergenic
941715063 2:168755090-168755112 AAATTTTAAAAGAAGGAGAGAGG + Intronic
942449808 2:176101675-176101697 AAATATCCAGGGGAGGAGAAGGG + Intergenic
943004065 2:182367989-182368011 AAACACACACAAAAGGAGAGAGG + Intronic
943066492 2:183091954-183091976 GACTATCCACAGTAGTAGAGGGG - Intronic
945262885 2:207861115-207861137 AAATATCCTCAAAAGGGTAGAGG + Exonic
945378915 2:209115598-209115620 AAAGATCTACAAAAGGACAGTGG - Intergenic
945406294 2:209452770-209452792 AAACATGCAGAGAAGTAGAGGGG + Intronic
945504358 2:210620237-210620259 AAATATTCACAGACTGAGATGGG + Intronic
947271396 2:228339940-228339962 TAATCTCCAAAGAAAGAGAGGGG - Intergenic
947287489 2:228532685-228532707 AAACATCCAAAATAGGAGAGTGG - Intergenic
1168747471 20:256064-256086 ATATATCCATAGATAGAGAGAGG + Intergenic
1169353052 20:4885501-4885523 TAAAATCCACTGAAAGAGAGAGG + Intronic
1169530227 20:6477103-6477125 AAGTATCCACAGACAAAGAGGGG + Intergenic
1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG + Intronic
1170418701 20:16171266-16171288 AAATATTTGAAGAAGGAGAGAGG + Intergenic
1171156521 20:22879515-22879537 AAGTATCCACAGAAAGAGTTAGG + Intergenic
1172742170 20:37177834-37177856 AAATATCCACATAAGGCTAGTGG + Intronic
1172942672 20:38665294-38665316 AAATAAACACAGAAGGCAAGGGG + Intergenic
1173183455 20:40821405-40821427 AAACCTCCACAGGAGGAGAGGGG - Intergenic
1173583814 20:44166748-44166770 ATGCATCCACAGAGGGAGAGAGG + Intronic
1174361371 20:50030852-50030874 AGAGAGCCACAGAAGGAGCGAGG + Intergenic
1175630816 20:60534966-60534988 AAATGTGCAGAGAAGGGGAGAGG + Intergenic
1176325562 21:5446045-5446067 AAATTTACACTTAAGGAGAGTGG - Intergenic
1176403566 21:6340417-6340439 AAATTTACACTTAAGGAGAGTGG + Intergenic
1176433591 21:6648687-6648709 AAATTTACACTTAAGGAGAGTGG - Intergenic
1177345797 21:19868050-19868072 TAATAGACACAGAATGAGAGAGG + Intergenic
1177990090 21:28027021-28027043 AAAGAGCTAGAGAAGGAGAGAGG - Intergenic
1179433041 21:41338151-41338173 AAATAAGCAAAGAAGGAGAGGGG - Intronic
1179585299 21:42370587-42370609 AAATTAACCCAGAAGGAGAGGGG + Intergenic
1180431134 22:15251249-15251271 AAATACCCACAGATGTGGAGGGG + Intergenic
1181550490 22:23636523-23636545 TTATACCCAGAGAAGGAGAGAGG + Intergenic
1181797788 22:25322169-25322191 TTATACCCAGAGAAGGAGAGAGG - Intergenic
1182751707 22:32646821-32646843 ACAGAACCACAGAGGGAGAGGGG - Intronic
1182858651 22:33540116-33540138 AAATATTCATAGAAAGAGAAGGG - Intronic
1183040904 22:35177269-35177291 GAAGAGCCAGAGAAGGAGAGTGG + Intergenic
1183300611 22:37057286-37057308 ACATACCCAAAGAAGAAGAGAGG - Intronic
1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG + Intronic
949713120 3:6895121-6895143 AGCTATCCACAGCAGGAGACAGG + Intronic
949804754 3:7942660-7942682 AAATACCCACAGATGTGGAGGGG + Intergenic
950018891 3:9772481-9772503 AAAAATCAAGACAAGGAGAGAGG - Intronic
950485214 3:13269358-13269380 AAACATCCAGAGAGGGAAAGGGG - Intergenic
950681496 3:14588363-14588385 CAGTGTCCAGAGAAGGAGAGAGG - Intergenic
953127588 3:40106600-40106622 AAATAAGAACAGAAGGAAAGTGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953276433 3:41504166-41504188 AAATATCAACATAAAAAGAGAGG + Intronic
953422612 3:42766098-42766120 AACTATGCAGAGAAGGAGAGGGG + Intronic
955765339 3:62338553-62338575 AAATATCCAGAGATGGATGGTGG + Intergenic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
957891200 3:86361493-86361515 AAATGTCCATAGGAGGACAGGGG - Intergenic
958477625 3:94604864-94604886 AATTATCCATACAATGAGAGTGG - Intergenic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
959625238 3:108442321-108442343 AAAGAAGCACAGATGGAGAGAGG + Intronic
961270552 3:125684495-125684517 AAATATCGGCAAAAGGCGAGAGG - Intergenic
961955959 3:130804470-130804492 AAATGCCCACAGAAGCAGACAGG - Intergenic
962160641 3:132996113-132996135 AAATCTACGCATAAGGAGAGGGG + Intergenic
963071292 3:141307520-141307542 AACTATCAACAGAAAGGGAGCGG - Intergenic
963740379 3:149074002-149074024 AAATATACACAGTAAGAGTGAGG - Intronic
964732537 3:159882739-159882761 AAATATGCACAGGAGTTGAGAGG - Intronic
966771824 3:183510937-183510959 AAATACCCACAGGTGTAGAGGGG - Intronic
966905688 3:184524224-184524246 AAATTTTCACAGCAGGAGAATGG + Intronic
967266672 3:187697887-187697909 AAATATCCACATATGGCTAGTGG + Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
968280753 3:197474949-197474971 AAATATCTCCAGTAGGAGATAGG + Intergenic
968920502 4:3519901-3519923 AAAGATTCACAGAATGACAGTGG + Intronic
969512737 4:7628769-7628791 AAAGCTCCAGAGAAGGACAGTGG + Intronic
969599719 4:8169085-8169107 CAATATGCAGAGCAGGAGAGAGG - Intergenic
970642508 4:18082770-18082792 AAATCTCAACAGATGGAGACAGG - Intergenic
971026141 4:22589752-22589774 TAATATCCAGGGGAGGAGAGGGG + Intergenic
971214811 4:24653008-24653030 AAATATTCTCAGAATGAGAAGGG + Intergenic
971745932 4:30580966-30580988 AAATAGCCAAAAAAGGAGATTGG - Intergenic
971985481 4:33817300-33817322 AAATATTTACAGTATGAGAGAGG - Intergenic
972254506 4:37338788-37338810 ACATGTCCAGAGAAGGAGATTGG - Intronic
973813275 4:54594309-54594331 AGATATCCACAAAAGGAAAGAGG + Intergenic
973941016 4:55910555-55910577 AATTAACCAGGGAAGGAGAGAGG - Intergenic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
977609463 4:99017310-99017332 AAATATCCAGAAAATGAGATAGG - Intronic
978438115 4:108707574-108707596 AAATTCCCACAGAAGGTGTGGGG + Intergenic
979403292 4:120277514-120277536 AAACATCTACAGAGGGAAAGTGG - Intergenic
980208185 4:129749128-129749150 AAATAACCAAAGAAAGTGAGAGG - Intergenic
980337211 4:131491401-131491423 AATTATAGACATAAGGAGAGAGG + Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
981013518 4:139950693-139950715 AACTATTCACAGAAGGCGTGTGG - Intronic
981635552 4:146874708-146874730 AAATAGCCAAAGAAGGTGGGTGG - Exonic
981936735 4:150247522-150247544 AAATGTCCACAGGAAGAGCGGGG - Intronic
982018779 4:151182583-151182605 AAAAAGCCAGACAAGGAGAGGGG - Intronic
982983408 4:162171251-162171273 AAACATGCACAGGAGGAAAGAGG - Intergenic
983624699 4:169790673-169790695 AAATATCCAGGGAGGGGGAGAGG - Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
986103804 5:4640621-4640643 AAACGTCCACAGAATGAGGGAGG + Intergenic
986547655 5:8916394-8916416 AACTATGCACAGAAGTAGAAAGG - Intergenic
987639641 5:20596058-20596080 AAATATCCCCAAATGAAGAGTGG - Intergenic
987742100 5:21922980-21923002 ATATATGGAGAGAAGGAGAGAGG + Intronic
988586406 5:32511313-32511335 AAAAATACACAGAAGGATATGGG + Intergenic
989275628 5:39585337-39585359 AAATATCTTCGGAAGAAGAGTGG + Intergenic
991581487 5:68160125-68160147 AAATATCAACACAATGAGAAAGG + Intergenic
993492728 5:88571432-88571454 AAATATCCATAGGTGGAGAAGGG + Intergenic
993509284 5:88751610-88751632 ATATAGCCACAGGAGGAGATAGG + Intronic
993936640 5:94012823-94012845 AAATCTCCTCACAAGGAGACAGG + Intronic
994091313 5:95811964-95811986 AAATACCCACAGGTGTAGAGGGG + Intronic
995651622 5:114376237-114376259 AAGTAGCCACAGAAGGAAAGGGG + Intronic
995740142 5:115347531-115347553 AAATATCCACAGGTGTGGAGGGG + Intergenic
995802294 5:116010932-116010954 AAATATGAAAAGAAGAAGAGAGG - Intronic
995981704 5:118112285-118112307 AAATCATCACAGAAGGAGAAAGG - Intergenic
996442104 5:123502985-123503007 AGATATCCATAGAAGTAGAAAGG + Intergenic
996529390 5:124511862-124511884 AAATAGCCTATGAAGGAGAGGGG - Intergenic
997173538 5:131750302-131750324 AAAAACGCAAAGAAGGAGAGTGG + Intronic
997768054 5:136524886-136524908 AAATAACCTCAGAAGAGGAGAGG - Intergenic
997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG + Intronic
998554349 5:143108689-143108711 AAATCCCCACAAAAGGAGATAGG + Intronic
998745390 5:145252688-145252710 AAATAACCCAAGGAGGAGAGAGG + Intergenic
999648942 5:153746766-153746788 AAAAATACACAGAAGGAAATGGG + Intronic
1000102392 5:158028720-158028742 AAAGAACAAGAGAAGGAGAGGGG - Intergenic
1000527093 5:162371087-162371109 AAATATCCACAGGTGTGGAGGGG + Intergenic
1000866922 5:166525252-166525274 AAATAACCAGAAAAGGAGACTGG + Intergenic
1003705865 6:8528259-8528281 CTATATGCACAGAAAGAGAGTGG + Intergenic
1003893398 6:10583947-10583969 AAATACCCACAGGAGTGGAGAGG - Intronic
1007289724 6:40776284-40776306 AAAGACCCACAGAAGAATAGTGG - Intergenic
1007519834 6:42443264-42443286 AAACATACACAAAAGCAGAGAGG - Intronic
1008516883 6:52326926-52326948 CAATATCCAAAGAGGGAAAGTGG + Intergenic
1008563091 6:52740941-52740963 AAATATCCAAAAACGGAGGGTGG - Intergenic
1008638214 6:53433592-53433614 AAAGATCCACAGTGGGAGAGAGG - Intergenic
1009879917 6:69554034-69554056 AAGCATCTATAGAAGGAGAGAGG - Intergenic
1011083889 6:83517558-83517580 AAAAGGCCACAGCAGGAGAGGGG - Intronic
1011325105 6:86142081-86142103 AAATTTCTACCTAAGGAGAGGGG + Intergenic
1011781636 6:90796335-90796357 AAATATCCACTGCAGGTGAAGGG + Intergenic
1012275485 6:97269375-97269397 AAATATTCTTAGAAGTAGAGTGG - Intronic
1012324608 6:97900686-97900708 AAATCTCCACATAAGGAATGGGG - Intergenic
1013564993 6:111349502-111349524 AAATATAGAAAGAAGGAGGGAGG - Intronic
1013629934 6:111976556-111976578 AAATATACACAGTTAGAGAGAGG - Intergenic
1014126004 6:117777689-117777711 AAATATAGAAAGGAGGAGAGTGG - Intergenic
1014347197 6:120287388-120287410 ACAAATCCACAGAAGGAAAAGGG - Intergenic
1014544659 6:122719906-122719928 AAAAATACACAGAAGGATATAGG + Intronic
1015187927 6:130439798-130439820 TAATATCCATGGAAGCAGAGAGG + Intronic
1015821551 6:137266648-137266670 AAATACACACAAATGGAGAGAGG + Intergenic
1015918642 6:138244556-138244578 AAACTCCCACAGAAGCAGAGTGG - Intronic
1015968743 6:138722101-138722123 AAATACCCACAGATGGATATTGG - Intergenic
1017191277 6:151655398-151655420 AAATATCCACAGAGTGACAAAGG + Intergenic
1018679043 6:166248541-166248563 AAATATTCACAAAAGGACAATGG - Intergenic
1018696380 6:166394809-166394831 ACAAGTCCCCAGAAGGAGAGAGG + Intergenic
1020844548 7:13266436-13266458 AACTATCCAGAGAGAGAGAGAGG + Intergenic
1021930374 7:25575213-25575235 TAATATCCAAAGATAGAGAGTGG - Intergenic
1022210905 7:28208336-28208358 AAATATCCATCATAGGAGAGTGG - Intergenic
1022811822 7:33876417-33876439 AAATATCCATAATAGGTGAGAGG + Intergenic
1023632384 7:42177251-42177273 AAATATCCCCTGATGCAGAGTGG + Intronic
1024208265 7:47182208-47182230 AGACACACACAGAAGGAGAGAGG - Intergenic
1024624007 7:51188611-51188633 AAATGTCCAAAGGAGTAGAGAGG + Intronic
1024682027 7:51700668-51700690 AAATATAAAGAGAAGGAGAAAGG + Intergenic
1025833268 7:65073215-65073237 AAATGTATCCAGAAGGAGAGAGG + Intergenic
1025903030 7:65762721-65762743 AAATGTATCCAGAAGGAGAGAGG + Intergenic
1026162461 7:67881546-67881568 AAATACCCACAGGTGTAGAGGGG - Intergenic
1027830263 7:83168004-83168026 AAAAATGCACAGATGGATAGAGG - Intergenic
1028473765 7:91232101-91232123 AAGTATCCACTGAAGTAGATAGG - Intergenic
1029350770 7:100011338-100011360 AAGTATCCAGAGAGAGAGAGAGG - Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1031933521 7:127712001-127712023 AAATAACCCAAGAAGGGGAGAGG - Intronic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032657124 7:133943011-133943033 AAATAGCCACACAAGGCTAGTGG - Intronic
1034023663 7:147672604-147672626 AAATATCCAGAGAAACAAAGTGG - Intronic
1034300159 7:150008486-150008508 AAATATCCACAGGTGGTTAGAGG + Intergenic
1034805891 7:154088824-154088846 AAATATCCACAGGTGGTTAGAGG - Intronic
1034846533 7:154451417-154451439 AAATGTCCACAGCAGCAAAGCGG + Intronic
1035612918 8:980249-980271 AAATATCCATAGAAGGTGCAGGG + Intergenic
1035763579 8:2087377-2087399 AAATAACCAGAGAAGGCCAGAGG - Intronic
1036218333 8:6899603-6899625 AAATATCTAGAGATGGATAGTGG - Intergenic
1036219076 8:6905814-6905836 AAATAAGCACAGAATGAGTGTGG + Intergenic
1037644557 8:20781234-20781256 AAATGTCCACAACAGGTGAGTGG + Intergenic
1038196566 8:25373466-25373488 AAATATCCCCATAAGAAAAGGGG - Intronic
1038427768 8:27475602-27475624 AAAAATCTACAGATGGACAGTGG + Intronic
1038513872 8:28167113-28167135 AAAAAGCCAGAGAAGGGGAGAGG + Intronic
1039493099 8:37962464-37962486 GAATATCCAGAGATGGGGAGAGG + Intergenic
1040124596 8:43722884-43722906 AAATATCCTCAGATGAAAAGTGG + Intergenic
1040398063 8:47018691-47018713 AACTATCCATAAAAGGAGGGAGG + Intergenic
1040520244 8:48170364-48170386 AAATATCCAAATAAGATGAGAGG - Intergenic
1041707012 8:60857311-60857333 AAATATCTACTTAAGGAGACAGG - Intronic
1041978530 8:63828153-63828175 AAACATACAATGAAGGAGAGGGG + Intergenic
1044498089 8:92915163-92915185 AAATATGTAGAAAAGGAGAGTGG + Intronic
1044846177 8:96384255-96384277 AAATATTCACAGAATAAAAGAGG + Intergenic
1047056413 8:121169541-121169563 AAATACACGTAGAAGGAGAGAGG - Intergenic
1048139487 8:131779553-131779575 TAATAGCAACAGAAGTAGAGAGG - Intergenic
1048422007 8:134286044-134286066 AAGTATCCAGAGTAGGAGACAGG - Intergenic
1048625071 8:136176225-136176247 ACACATACACAGAAAGAGAGAGG + Intergenic
1050019695 9:1270054-1270076 AAAAAGAGACAGAAGGAGAGAGG - Intergenic
1050119238 9:2291282-2291304 ATATATCCACAGAGGGAAAAGGG - Intergenic
1050704870 9:8385611-8385633 AAATAACCAAAAAAGGGGAGAGG + Intronic
1051802132 9:20947007-20947029 AAATGTCCACAGAATGAGACAGG - Intronic
1052210468 9:25896943-25896965 AAATATGAACAGAAGGACTGAGG - Intergenic
1053764845 9:41382058-41382080 ATATATACACAGAGAGAGAGAGG - Intergenic
1054961701 9:70976973-70976995 TAAAATCCCCAGAATGAGAGAGG - Intronic
1055928288 9:81533028-81533050 AAGTCTCCAAAGAAGGAGTGGGG + Intergenic
1055959005 9:81801845-81801867 AAATATACAAGGAAGTAGAGAGG + Intergenic
1056045924 9:82715808-82715830 AAAACTACACAGAAGGAAAGAGG - Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1058484323 9:105428387-105428409 AAATATCCACACAAGTTGATGGG - Intronic
1058520271 9:105809219-105809241 CAAAATAGACAGAAGGAGAGAGG + Intergenic
1059215573 9:112558493-112558515 AAATATTCAAAGAAGTAGAGAGG - Intronic
1059393724 9:114017465-114017487 AAATATCCAGAAAAGGAGCTGGG - Intronic
1059641229 9:116218899-116218921 AAAACTCCAGAGAAGGAAAGGGG + Intronic
1061135709 9:128732086-128732108 AAATACCCAGAGTGGGAGAGAGG + Intronic
1062134941 9:134921333-134921355 AAAAATCCACATCAGGAGAAGGG + Intergenic
1203437945 Un_GL000195v1:159983-160005 AAATTTACACTTAAGGAGAGTGG + Intergenic
1203732849 Un_GL000216v2:106482-106504 AAATATATACAGAGAGAGAGAGG - Intergenic
1185945538 X:4371712-4371734 AAATATCCTGAGATGGGGAGAGG + Intergenic
1186323014 X:8451194-8451216 AAATAACTACAGAAGGAGTTTGG + Intergenic
1186659955 X:11659697-11659719 AAATGACCACACAAGAAGAGTGG + Intronic
1187754587 X:22508468-22508490 AAATGTGCACAGAAGTAGAATGG - Intergenic
1188211281 X:27428195-27428217 CAATGTCCACAGAAGCAGGGAGG + Intergenic
1188484340 X:30666827-30666849 ATAAATACACAGAAGGAGACTGG + Intronic
1188663207 X:32786707-32786729 AAATATTCATGGAAGAAGAGAGG + Intronic
1189006660 X:37002223-37002245 AAATATGCATATAAGGAGACAGG + Intergenic
1189156216 X:38759505-38759527 AAATATCAAATGGAGGAGAGGGG - Intergenic
1189850608 X:45172902-45172924 AAATATCCATAGGAGGTCAGTGG + Intronic
1190753189 X:53380037-53380059 AAATATCCAGAGATTGGGAGAGG + Exonic
1191224410 X:58027512-58027534 AGATATCCAAATAAGAAGAGAGG - Intergenic
1191663984 X:63679175-63679197 AAATATGTACATAAAGAGAGGGG + Intronic
1193784529 X:85743514-85743536 ATATATCCAAAGAGGAAGAGAGG + Intergenic
1194048438 X:89037185-89037207 AATAATCCACACAGGGAGAGAGG + Intergenic
1195441513 X:104904107-104904129 CAATATACAAATAAGGAGAGAGG - Intronic
1195527725 X:105911096-105911118 AATTAATCACAGAAGAAGAGAGG - Intronic
1196277916 X:113790335-113790357 AAATACCCACATAATGGGAGTGG - Intergenic
1196619350 X:117804902-117804924 AAATATGGAAAGAAGGAAAGAGG + Intergenic
1197956650 X:131957293-131957315 AAACAATCACAGAAAGAGAGTGG + Intergenic
1198260203 X:134959030-134959052 AAATATATACAGAATGAGATGGG - Intergenic
1198421012 X:136470749-136470771 AAAACTCCAAAGTAGGAGAGAGG + Intergenic
1199024221 X:142918519-142918541 AAATGACCACAGGAGGAGACTGG - Intergenic
1199465405 X:148129935-148129957 AAATATCCAGAGGAAGGGAGGGG + Intergenic
1199519416 X:148718665-148718687 AAACACACATAGAAGGAGAGAGG - Intronic
1199566915 X:149225006-149225028 AAATATCCATAGAAGAAAAGGGG + Intergenic