ID: 968001054

View in Genome Browser
Species Human (GRCh38)
Location 3:195207084-195207106
Sequence TACCACAGGCTGAGCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968001046_968001054 28 Left 968001046 3:195207033-195207055 CCATCAGTAAGAGAGAGAAACAA 0: 1
1: 0
2: 5
3: 42
4: 454
Right 968001054 3:195207084-195207106 TACCACAGGCTGAGCCAGCCTGG 0: 1
1: 0
2: 3
3: 18
4: 213
968001050_968001054 -3 Left 968001050 3:195207064-195207086 CCTGGGTCTTCAGACCCTTCTAC 0: 1
1: 0
2: 1
3: 12
4: 174
Right 968001054 3:195207084-195207106 TACCACAGGCTGAGCCAGCCTGG 0: 1
1: 0
2: 3
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968001054 Original CRISPR TACCACAGGCTGAGCCAGCC TGG Intronic
900373332 1:2342150-2342172 ACCGAGAGGCTGAGCCAGCCCGG + Intronic
900733337 1:4277776-4277798 TTCCACAGGCTTTGCCATCCTGG + Intergenic
901202491 1:7474642-7474664 TCCCAAAGCCTGAGCCAGGCAGG + Intronic
901514004 1:9733147-9733169 CAACTCAGGCTGAGGCAGCCAGG + Intronic
902121527 1:14169982-14170004 TTCCACAGGCTGTGGCAGGCTGG + Intergenic
903684192 1:25119143-25119165 GACCAGAGGCCCAGCCAGCCAGG + Intergenic
904353581 1:29924460-29924482 TAACACAGCCTGGGCCTGCCTGG + Intergenic
905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG + Intergenic
905894578 1:41536996-41537018 TACAAGAGGCGGATCCAGCCTGG + Intronic
905990717 1:42335056-42335078 TACCTCAGGCTGCGCAGGCCGGG + Intronic
910220922 1:84888961-84888983 CACCTCAGGCTGGGCCAGACTGG - Intronic
911179851 1:94850624-94850646 AAGCAGAGGCAGAGCCAGCCTGG - Intronic
912947223 1:114095462-114095484 TTCCACAGGCAGGCCCAGCCTGG + Intronic
915128365 1:153680722-153680744 TGCCACAAGCTGAGACAGCCTGG - Intronic
916126601 1:161576859-161576881 CCCCACAAGCTGAGACAGCCAGG - Intergenic
916136520 1:161658699-161658721 CCCCACAAGCTGAGACAGCCAGG - Intronic
917442940 1:175082843-175082865 TATCCCAGGCTGAGGGAGCCTGG - Intronic
918508917 1:185288879-185288901 TACTTCAGGCAAAGCCAGCCAGG - Intronic
920201306 1:204261434-204261456 CCCCACAGGCTGAGCATGCCGGG - Exonic
922890449 1:229057974-229057996 TTCCACTGGGTGACCCAGCCTGG - Intergenic
923394127 1:233543832-233543854 TTCCAGAGGCTGAACAAGCCCGG - Intergenic
924249130 1:242113807-242113829 CACCACAGGAGAAGCCAGCCTGG - Intronic
1062840540 10:666830-666852 TACCACAGGCAGACCCCGGCCGG + Intronic
1068043991 10:51862417-51862439 GACCACAGAGTGAGCCAGTCAGG + Intronic
1070570970 10:77638796-77638818 TTCCACAGGCTGAGCTCCCCAGG + Intergenic
1071796448 10:89011759-89011781 TACCACAGGCTGGCCTAGCAAGG - Intronic
1072236591 10:93459097-93459119 GAGCACAGGCAGAACCAGCCAGG - Intronic
1072944441 10:99797060-99797082 AACCACAGGCTGAGACCCCCAGG - Intronic
1075442406 10:122490622-122490644 GACCAGAGGCTGAGCCAGGTGGG + Intronic
1075740832 10:124694997-124695019 TGCCACTGGCAGAGCCAGCGGGG + Intronic
1076669798 10:132113478-132113500 TTCCTCAGGCTGGGACAGCCAGG - Intronic
1076670571 10:132118552-132118574 TTCCACATGCTGGCCCAGCCTGG - Intronic
1078563727 11:12395546-12395568 TAACCCAGGCTGAGCCAATCTGG - Intronic
1079102073 11:17547957-17547979 AGCCACAGCCAGAGCCAGCCGGG + Intronic
1080268647 11:30426945-30426967 TACCAGAGACTGAGCCTGCAAGG + Intronic
1081751581 11:45514876-45514898 TACCAGTGGCTCAGGCAGCCTGG + Intergenic
1081854442 11:46295035-46295057 AAGCACAGACTGAACCAGCCTGG + Intronic
1083257059 11:61503068-61503090 TGGCAGTGGCTGAGCCAGCCTGG + Intergenic
1084443885 11:69192307-69192329 TATCAAAGGCTTAGCCAGGCTGG - Intergenic
1084857913 11:72000648-72000670 TACCACCAGCTGAGCCAGCTGGG + Intronic
1085203788 11:74718080-74718102 TGCCAAAGGCTGAGCCACCTGGG - Intronic
1085461748 11:76698227-76698249 TGCCACAGGCCAAGCCTGCCAGG + Intergenic
1086963348 11:93002757-93002779 CACCACAGGCAGAACAAGCCTGG + Intergenic
1088159691 11:106854647-106854669 TACCACATGCTCATCCATCCGGG - Intronic
1088526603 11:110762767-110762789 TATCACAGGCAGAGGCAGCTAGG - Intergenic
1089968427 11:122672857-122672879 TACTGCAGGCTGGCCCAGCCTGG - Intronic
1091928005 12:4371028-4371050 AACCACAGGCCAGGCCAGCCCGG - Intronic
1093055634 12:14553281-14553303 AACCACAGGCTGGGGCATCCTGG - Exonic
1093126072 12:15330171-15330193 TCCCAAAGGTAGAGCCAGCCTGG + Intronic
1093210925 12:16308002-16308024 TAAGCCAGTCTGAGCCAGCCGGG - Intergenic
1095990406 12:48030381-48030403 TGCCACAGCCTGAGCCAGAGTGG - Intergenic
1097191264 12:57220666-57220688 TCCCACAGCCTGATCCTGCCTGG + Intronic
1098973481 12:76878960-76878982 TACCGCAGGCGGAGCTAGCGAGG + Exonic
1099069603 12:78029059-78029081 GACCAGAGGCTGTGCCAGGCAGG - Intronic
1101863426 12:108501001-108501023 CACCACTGGGTGATCCAGCCTGG + Intergenic
1102033726 12:109759305-109759327 TACCGCAGAGTGAGCCAGGCAGG - Intronic
1103214578 12:119191699-119191721 TACAATAGGCAGAGCCAGCAGGG + Intronic
1104048949 12:125183850-125183872 CAAGACAGGCTGAGCCAGGCTGG + Intergenic
1104635527 12:130435997-130436019 CCCCACAGGCTGACCCAGCAGGG + Intronic
1105896831 13:24723765-24723787 AACCAGAGGCTGAGCAAGCTGGG + Intergenic
1106389412 13:29320534-29320556 CAGCACAGGCTGAGACACCCAGG + Intronic
1113442972 13:110343651-110343673 CACCTGAGGCTGAGCCTGCCCGG + Intronic
1113877102 13:113601438-113601460 TTCCTCAGGGTGAGCCAGCAAGG + Intronic
1114757595 14:25277746-25277768 TGACACAGGCAGAACCAGCCTGG - Intergenic
1121360113 14:93249321-93249343 TAAAACATGCTGAGACAGCCTGG + Intronic
1121781241 14:96623856-96623878 TTCGCCAGGCTGGGCCAGCCTGG - Intergenic
1122504956 14:102226544-102226566 TCCTATGGGCTGAGCCAGCCTGG + Intronic
1123703309 15:22931999-22932021 TGCCACAGGCTGTACCATCCAGG + Intronic
1124279018 15:28347679-28347701 GACCCCAGGCTGGGCGAGCCTGG - Intergenic
1124303680 15:28563929-28563951 GACCCCAGGCTGGGCGAGCCTGG + Intergenic
1125895909 15:43301706-43301728 CCCCGCAGGCTGGGCCAGCCTGG - Intronic
1126095182 15:45083313-45083335 TACCACAGGGTGAGTAAGGCTGG - Intergenic
1127567322 15:60204404-60204426 TACCTAAGCCTGAGCCAGCATGG + Intergenic
1127609809 15:60626080-60626102 TAACACAGGCTGAGCATTCCTGG - Intronic
1128381509 15:67116533-67116555 TACCACACGCTTCTCCAGCCAGG - Intronic
1128522102 15:68382304-68382326 TGTCACAGGGTGAGCCATCCCGG + Intronic
1129846219 15:78768827-78768849 CACCCCAGCCTGGGCCAGCCTGG - Intronic
1130199335 15:81810594-81810616 CACCACAGTCTGAACCAGCCAGG + Intergenic
1130255906 15:82325982-82326004 CACCCCAGCCTGGGCCAGCCTGG + Intergenic
1130599051 15:85264004-85264026 CACCCCAGCCTGGGCCAGCCTGG - Intergenic
1132597950 16:761771-761793 ATCCACAGGCAGAGCCTGCCTGG - Intronic
1141556544 16:84840186-84840208 TGCCACAGGCTGAGCTGGCCTGG + Intronic
1141848321 16:86626486-86626508 TACCACAGGGAGTGCCATCCCGG + Intergenic
1142283618 16:89161778-89161800 GACCCCAGGCTCTGCCAGCCAGG + Intergenic
1142829973 17:2541546-2541568 TACCCCAGCCTGAGACAGACAGG - Intergenic
1143567739 17:7734810-7734832 TAGCACAGACTGACCCACCCAGG + Intronic
1143636155 17:8164630-8164652 TCACATAGGCTGAGCCACCCGGG - Intergenic
1145288200 17:21522201-21522223 GGCCACAGGCCGAGCCATCCAGG - Intergenic
1145389440 17:22444242-22444264 GGCCACAGGCTGTGCCATCCAGG + Intergenic
1145728249 17:27153647-27153669 TGGTACAGGCAGAGCCAGCCTGG + Intergenic
1146916159 17:36679745-36679767 TACTAGAGACAGAGCCAGCCAGG - Intergenic
1148101863 17:45097141-45097163 TGCCACTGGGGGAGCCAGCCGGG - Exonic
1148123204 17:45224156-45224178 TAAGACAGGCTGAGCCACCCCGG - Intronic
1152005661 17:77678802-77678824 TACCACAGGCTGTACCACCTGGG - Intergenic
1153595917 18:6725153-6725175 GACCACACGGTGAGCCACCCAGG + Intergenic
1163203847 19:15787905-15787927 GAGGACAGGCTGATCCAGCCTGG - Intergenic
1163229355 19:15989772-15989794 GACCACAGGCAGGGCCAGCCTGG - Intergenic
1164869579 19:31631852-31631874 TGCAACATTCTGAGCCAGCCAGG + Intergenic
1165300990 19:34968811-34968833 TACCAGAGGCTGAGGTTGCCAGG - Intergenic
1167374540 19:49103835-49103857 CACCCCAGCCTGAGCCTGCCAGG - Intronic
1167423237 19:49415811-49415833 TACCACCTGCTGTGCCAGGCAGG - Intronic
1167728534 19:51235655-51235677 TACCACAGGGTCAGCCTCCCCGG + Exonic
926195538 2:10761544-10761566 TACCAATGTCTGAGTCAGCCTGG + Intronic
927083651 2:19654075-19654097 GTCCACAGGCTGAGGCAGCGTGG + Intergenic
927258594 2:21062802-21062824 CACCACAAGCAGAGCCAGACAGG - Intergenic
929610887 2:43269883-43269905 AACCACACCCTGAGTCAGCCCGG - Intronic
930829432 2:55727021-55727043 TACAACAGGGTGAGTTAGCCTGG - Intergenic
931652692 2:64482791-64482813 AACCAAAGGCTAAGCCTGCCAGG - Intergenic
931789649 2:65653235-65653257 TACCACATGCTGAGTGAGACAGG - Intergenic
934017988 2:87909889-87909911 TACCACAGGGTGTGTCATCCGGG - Intergenic
936709272 2:115112697-115112719 TACCAGAGGCTGAGGTAGCGGGG + Intronic
937884771 2:126892181-126892203 TACCTAAGGGTGAGCCAGCACGG - Intergenic
937910861 2:127074994-127075016 TAGAACAGGCTGAGCTGGCCGGG - Intronic
941037197 2:160581390-160581412 TACATCAGGCTGTGGCAGCCAGG - Intergenic
946017902 2:216619105-216619127 TACCATAGGCAAAGCCAGGCAGG + Intergenic
946185380 2:217978090-217978112 CATCAGGGGCTGAGCCAGCCTGG + Intronic
946846160 2:223860704-223860726 TCCCCCATGCTGAGCCATCCTGG + Intronic
948684766 2:239663591-239663613 TACCCCAAGCAGAGCCAGGCTGG - Intergenic
1168821369 20:775707-775729 CAGGACAGGCTGAGCCATCCAGG - Intergenic
1169230882 20:3888473-3888495 TACCAAAGGCTGCCCAAGCCCGG - Intergenic
1169984624 20:11430200-11430222 TGCCAGAGGCAGAGCAAGCCAGG + Intergenic
1174596555 20:51688766-51688788 TACCAGAGGGGGAGGCAGCCTGG - Intronic
1176024486 20:62978782-62978804 TCCCGCAGCCTGAGCCAGCATGG + Intergenic
1176241468 20:64077648-64077670 TACCACAGGGTGCGCCAGCCAGG + Intronic
1178477206 21:32947393-32947415 AACCAGAGACTGAGCCAGGCAGG + Intergenic
1178821651 21:35981021-35981043 TATCACAGGATGGGGCAGCCTGG + Intronic
1179631089 21:42679179-42679201 TTCCACCTACTGAGCCAGCCTGG - Intronic
1180732277 22:17991093-17991115 GAGCAGAGGCTGGGCCAGCCAGG + Intronic
1180829120 22:18889267-18889289 TGCCACTGTCTGTGCCAGCCAGG - Intergenic
1181237541 22:21456753-21456775 GACCACAGGCTGAGCCTCCGAGG - Intergenic
1182419770 22:30243284-30243306 GACCACAGGGTGAGACAGCAGGG - Exonic
1184167006 22:42735643-42735665 TGCAGCAGGGTGAGCCAGCCTGG + Intergenic
1184477796 22:44730782-44730804 GACCACAGGCAGAGCTGGCCTGG + Intronic
1203279211 22_KI270734v1_random:115254-115276 TGCCACTGTCTGTGCCAGCCAGG - Intergenic
949188642 3:1224248-1224270 TACCAGAGGCTGAGTCAGGGAGG + Intronic
952166596 3:30756648-30756670 TACCACTGGCAGAACAAGCCTGG + Intronic
952272676 3:31848020-31848042 TCCCTCAGGCTGAGCCTACCTGG + Intronic
954097750 3:48343522-48343544 TACATCAGGCTCATCCAGCCAGG + Intergenic
956382128 3:68675577-68675599 TACCAAAGGCTCAGTCAGCCAGG + Intergenic
957655200 3:83065056-83065078 TAGCACAGGCTGGTCCAGCATGG + Intergenic
960608361 3:119531552-119531574 CACCACAGGCGGAGCTAGCAAGG + Intronic
961223621 3:125219573-125219595 TCACACAGGCTGAGAGAGCCTGG + Intergenic
961865397 3:129950094-129950116 GACCACAGCCTGGGCCAGACAGG - Intergenic
962974836 3:140436991-140437013 TCACACAGGCTGAACCAGGCAGG + Intronic
965737278 3:171834536-171834558 TATCACAGGCAGAGCCAGCAAGG - Intergenic
966915448 3:184581938-184581960 TACCCCAGCCTGACCCTGCCAGG - Exonic
967198015 3:187046146-187046168 TACCACAGCCTGGGCAGGCCTGG - Intronic
968001054 3:195207084-195207106 TACCACAGGCTGAGCCAGCCTGG + Intronic
968549477 4:1214760-1214782 TACCACAGGGGGACCAAGCCAGG - Intronic
977898536 4:102392565-102392587 TACAACAGAGTCAGCCAGCCTGG + Intronic
981000373 4:139823406-139823428 TACCACTGGCTGTGGCAGCCAGG + Intronic
985171538 4:187155145-187155167 TTCCACAGTCTGAACCAACCTGG + Intergenic
986448732 5:7846236-7846258 TAGCACAGGCTGAGTCATCCTGG - Intronic
989440514 5:41466712-41466734 TACCAGAGGCTGAGGGAGGCAGG - Intronic
989560191 5:42841487-42841509 TACCACAGGCTGAGCCAGTAGGG + Intronic
992091578 5:73322535-73322557 GACCCCAGGCTGAGCAGGCCAGG - Intergenic
992565741 5:77993890-77993912 TGCAGCAGGCTGAGCCAGCCGGG + Intergenic
1001646873 5:173288632-173288654 GACCACAGGCTGAGGCTACCTGG + Intergenic
1001996117 5:176160371-176160393 CACCAGAAGCTGAGACAGCCAGG + Intergenic
1003529198 6:6923835-6923857 TACGACAGGCAGAGCCTTCCTGG - Intergenic
1004193946 6:13487582-13487604 TCCCAGAGCCTGAGCCGGCCTGG - Intronic
1004454504 6:15779337-15779359 TACCAAGGGCTGAGCCATCAGGG - Intergenic
1005578950 6:27215607-27215629 TACTACAGGCTGACGCCGCCAGG + Intergenic
1007787050 6:44286592-44286614 TGCCTCAGGCTGGGCCTGCCTGG + Intronic
1008638409 6:53435762-53435784 TACCACACGATGAGACAACCAGG - Intergenic
1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG + Intronic
1013931291 6:115536871-115536893 TTTCACAGGCTGGGCCATCCTGG - Intergenic
1016653985 6:146496625-146496647 TGCCATAGCCTGAGCCAGTCAGG - Intergenic
1017703320 6:157096654-157096676 TGCCAGAGGCAGTGCCAGCCTGG - Intronic
1017983480 6:159422624-159422646 CTCCACAGTCTGAGCCAGACAGG - Intergenic
1018415523 6:163599350-163599372 GACCACAGGCCTACCCAGCCTGG + Intergenic
1019363217 7:616533-616555 GACCACAGCCTGAGGAAGCCAGG - Intronic
1019509681 7:1411626-1411648 AACCACAGGCAGGGCCCGCCGGG - Intergenic
1024001316 7:45191028-45191050 TTCCACAGGCTGTCACAGCCAGG - Intergenic
1024026768 7:45416229-45416251 TGCCACAGGCTGGGGCAGCAGGG - Intergenic
1024247920 7:47484481-47484503 AACCACAGGATGAGGCGGCCGGG + Intronic
1028830932 7:95325817-95325839 TACCACTGGCTAAGCCACCCTGG + Intergenic
1029439870 7:100581710-100581732 TACCGCAGCCTGAGCCAACTGGG + Intronic
1030521843 7:110607218-110607240 TTCCACTGGCTGAGCCTACCTGG - Intergenic
1030522905 7:110620407-110620429 TCCCACTGGCTGAGCCTACCTGG - Intergenic
1031783663 7:126001570-126001592 CTCCACAGGCTAAGCCAGCATGG - Intergenic
1032264342 7:130360400-130360422 GACCACAGTTAGAGCCAGCCAGG + Intronic
1034544790 7:151782662-151782684 TGCCACCTGCTGAGCCAACCTGG + Intronic
1035227366 7:157441133-157441155 TTCCAAAGGCTGAGGAAGCCAGG + Intergenic
1035261127 7:157662372-157662394 AACACCAGGCTGAGCCAGGCTGG + Intronic
1035287642 7:157816426-157816448 TGGCAGAGGCCGAGCCAGCCTGG + Intronic
1035756011 8:2033661-2033683 TCCCGCTGGCTGAGTCAGCCAGG + Intergenic
1036651874 8:10649478-10649500 GACCACAGCCTGCCCCAGCCAGG + Intronic
1037904807 8:22709830-22709852 TACTCCAGGTTGAGCCATCCTGG - Intergenic
1037939643 8:22941896-22941918 TACCCAAGTGTGAGCCAGCCTGG - Intronic
1045443568 8:102238824-102238846 TACCTCATCCTGATCCAGCCCGG + Exonic
1046292345 8:112179690-112179712 TTCTACAGGCTGTGCCAGCATGG + Intergenic
1047126298 8:121964934-121964956 TACCAGGGGCTGAGCAAACCGGG + Intergenic
1047307409 8:123663846-123663868 CCCCACATGCTGAGGCAGCCAGG + Intergenic
1048427568 8:134336922-134336944 TACCTCAGGCTGAGTCAGGGGGG - Intergenic
1049305747 8:141902868-141902890 TGACACGGGCTCAGCCAGCCAGG + Intergenic
1049518863 8:143078094-143078116 AGCCACAGGCTGTGCCCGCCAGG + Intergenic
1051262269 9:15276215-15276237 AACCACATGGTGAGCCAGGCAGG - Intronic
1053303044 9:36965138-36965160 AAGGAAAGGCTGAGCCAGCCTGG - Intronic
1057314903 9:93961692-93961714 TACCAGAGGCTGATCCTGCCTGG - Intergenic
1057929870 9:99184257-99184279 TGCCACGGTCGGAGCCAGCCGGG - Intergenic
1059035562 9:110750440-110750462 TCAAACAGGCTAAGCCAGCCAGG - Intronic
1062511253 9:136907369-136907391 TCCCACACACTGAGCCACCCAGG - Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1185722382 X:2392429-2392451 TTCCAGAGGCAAAGCCAGCCCGG + Intronic
1186760316 X:12716278-12716300 AACCAGCAGCTGAGCCAGCCCGG + Exonic
1187109614 X:16283337-16283359 CTCCACAGGCTGGGGCAGCCTGG - Intergenic
1187818033 X:23254907-23254929 TACCAGAGGCTGAGCAAGGGAGG + Intergenic
1191183948 X:57590965-57590987 CACCACAGGCCCAGCAAGCCTGG + Intergenic
1196495902 X:116324928-116324950 AACCACAGGCTGAGTCAGACTGG - Intergenic
1197553059 X:127918638-127918660 TAACACAGGCTCACCCATCCAGG + Intergenic
1198251133 X:134880265-134880287 GATTACAGGCTGAGCCAGGCTGG - Intergenic
1198596982 X:138247195-138247217 TACCAAAGGCAAAGCCAGCCGGG - Intergenic
1199126544 X:144129120-144129142 TACCACAGGGTGTGTCATCCGGG + Intergenic
1200697456 Y:6373653-6373675 CGCTACAGGCAGAGCCAGCCTGG + Intergenic
1200704012 Y:6426161-6426183 TAATACAGGCAGAGCCAGACTGG + Intergenic
1200709263 Y:6469079-6469101 TGGTACAGGCAGAGCCAGCCTGG + Intergenic
1200916242 Y:8573665-8573687 TGTTACAGGCAGAGCCAGCCTGG - Intergenic
1200921575 Y:8618073-8618095 TGCCACAGGCAGAGCCGGCATGG - Intergenic
1200923708 Y:8635581-8635603 GAGTACAGGCAGAGCCAGCCTGG - Intergenic
1200935761 Y:8736912-8736934 TAGTGCAGGCAGAGCCAGCCTGG + Intergenic
1200940328 Y:8773931-8773953 TGGTACAGGCAGAGCCAGCCTGG + Intergenic
1200960451 Y:8991527-8991549 TGTTACAGGCAGAGCCAGCCTGG - Intergenic
1200963822 Y:9018659-9018681 TGGGACAGGCAGAGCCAGCCTGG + Intergenic
1201024849 Y:9695629-9695651 TGGTACAGGCAGAGCCAGCCTGG - Intergenic
1201030099 Y:9738547-9738569 TAATACAGGCAGAGCCAGACTGG - Intergenic
1201036657 Y:9791046-9791068 CGCTACAGGCAGAGCCAGCCTGG - Intergenic
1202125798 Y:21567909-21567931 TGCTACAGGCAGAGCCAGCCTGG - Intergenic
1202149281 Y:21830125-21830147 TGGGACAGGCAGAGCCAGCCTGG - Intergenic
1202150097 Y:21836625-21836647 TAGTACAGGCAGAGCCGGCCTGG + Intergenic
1202153206 Y:21861470-21861492 TGCTACAGGCAGAGCCAACCTGG + Intergenic
1202180749 Y:22137847-22137869 TAATACAGGCAGAGCCAGCCTGG + Intergenic
1202183223 Y:22157269-22157291 TGGTACAGGCAGAGCCAGCCTGG + Intergenic
1202208136 Y:22429132-22429154 TGGTACAGGCAGAGCCAGCCTGG - Intergenic
1202210611 Y:22448553-22448575 TAATACAGGCAGAGCCAGCCTGG - Intergenic