ID: 968001330

View in Genome Browser
Species Human (GRCh38)
Location 3:195208859-195208881
Sequence TCCTCTTGCAAGCCCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968001330 Original CRISPR TCCTCTTGCAAGCCCCCTGC TGG (reversed) Intronic
900641308 1:3689252-3689274 GTCTCTGGGAAGCCCCCTGCAGG - Intronic
901062024 1:6475961-6475983 TCCTCCTCCAAGTCCACTGCGGG + Exonic
902256097 1:15189596-15189618 TCCTCCTGCAAGCCCCACGGTGG - Intronic
903280494 1:22247348-22247370 TTCTGTTGCAAGCCTCCAGCTGG - Intergenic
904274219 1:29369741-29369763 TCTGCTTCCAGGCCCCCTGCTGG + Intergenic
915364949 1:155309827-155309849 TCCTGCTGCCAGCCCCCTACTGG + Exonic
915583184 1:156828488-156828510 TCCTCTTCCACGCTCCCTGCTGG + Intronic
920060231 1:203222325-203222347 TCCTCTTCCATGCCTCCTGCAGG - Exonic
923086624 1:230707623-230707645 TCCCCTTGCACGTTCCCTGCAGG + Intronic
924710524 1:246527187-246527209 CTCTCCTGCCAGCCCCCTGCAGG + Intergenic
1063910194 10:10821481-10821503 TCTCCTTGGAAGCCCCCTCCAGG + Intergenic
1064941620 10:20741768-20741790 TCCTCATGCAAGCTCCCTAGGGG + Intergenic
1067061461 10:43080000-43080022 TCTGCTTGCAGGCCCCCAGCAGG - Intronic
1068002623 10:51353773-51353795 TCATCTGGCAATCCCACTGCTGG + Intronic
1068711544 10:60140697-60140719 TCCTCTGGCAAGCCTCTAGCAGG + Intronic
1068867675 10:61911897-61911919 TCATTTTGCAAGACCCCAGCAGG - Intronic
1069721379 10:70551618-70551640 TCCTTTTCCTGGCCCCCTGCCGG + Intronic
1072532580 10:96332985-96333007 TCCTATTTCAATCCCCTTGCTGG - Intronic
1075000660 10:118794775-118794797 TCCTCTTGCTGGCCCCCTCATGG - Intergenic
1075280880 10:121137245-121137267 TCCTCCTGCAGGCCTTCTGCAGG - Intergenic
1076199097 10:128544085-128544107 TCTTCTTGGAAGCACACTGCAGG - Intergenic
1077123975 11:924502-924524 TCCTCCAGGAAGCCCTCTGCTGG + Intergenic
1077453307 11:2663707-2663729 GGGTCTTGCAAGGCCCCTGCAGG + Intronic
1077462041 11:2715567-2715589 TCCTCTTCCACCACCCCTGCTGG + Intronic
1077630389 11:3807775-3807797 TCCTCCTGCAAGCACACTGGTGG - Intronic
1077906747 11:6540103-6540125 ACCTAGTGAAAGCCCCCTGCTGG + Intronic
1081703151 11:45164462-45164484 TTCTCTTGCACGCCCCCAGATGG - Intronic
1083662335 11:64257302-64257324 GCCTCTTAAAAGCACCCTGCAGG - Intronic
1084653749 11:70503500-70503522 CACTCTTGTAAGCACCCTGCTGG - Intronic
1085507839 11:77070228-77070250 TTCTCTTGCATGCCCACTGTGGG - Intronic
1089350601 11:117819645-117819667 CCCTCTTCCCAGCCCCCTCCTGG - Intronic
1094064629 12:26350044-26350066 TCCTCCTGCAAGCCCTGTGCTGG - Intronic
1103927815 12:124433467-124433489 CCGTCTTGCCAGCGCCCTGCCGG - Intronic
1105071106 12:133235229-133235251 CCCTCCTCCAAGGCCCCTGCAGG - Exonic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1105492505 13:20902548-20902570 TCCACTTCCAGGCTCCCTGCAGG + Intronic
1109054878 13:57534379-57534401 TCCCCTTGCAAGGCACCTGCTGG - Intergenic
1112142081 13:96655391-96655413 TTCTATTGCAATCCCCCTCCTGG - Intronic
1112849804 13:103691505-103691527 TACTTTTGCAGGCCTCCTGCTGG - Intergenic
1113747533 13:112755417-112755439 TCCTCTGGCAAGCGCCCTGTGGG - Intronic
1116288525 14:43003893-43003915 GCCTCTTGCAAGCCTCATGTAGG + Intergenic
1116716261 14:48430845-48430867 CCCTGTTGCAAGCCCCTTGAAGG - Intergenic
1117802881 14:59463897-59463919 TCCTGTTGCAGGCCCCCAGCCGG + Exonic
1118312625 14:64704803-64704825 CCCCCGTGCCAGCCCCCTGCGGG + Intronic
1120236629 14:81899190-81899212 TCATCTAGCAATCCCACTGCTGG - Intergenic
1121110148 14:91307147-91307169 AACTCTTTCAAGCACCCTGCGGG - Exonic
1122870844 14:104637781-104637803 TCCTCTTGCATAGACCCTGCTGG - Intergenic
1124613649 15:31225856-31225878 TCCTATTACAGGCCCACTGCAGG - Intergenic
1125132177 15:36295885-36295907 TCCTATTGCAAGGAGCCTGCAGG + Intergenic
1125325654 15:38533784-38533806 AACTCTTGCAAGCATCCTGCTGG - Intronic
1126397139 15:48230823-48230845 TCCTCTTTCAAGCTGCCTGTGGG + Intronic
1129195687 15:73964901-73964923 TGCTCTTGCCCGCCCCCTGGTGG + Intergenic
1129267646 15:74402639-74402661 TCCTCTGACAGGCCCCATGCTGG + Intergenic
1132295387 15:100730668-100730690 TCCTCTGACATGCACCCTGCTGG - Intergenic
1132787907 16:1668336-1668358 TCCACCTGCAAGGTCCCTGCTGG - Intronic
1132862459 16:2078340-2078362 TCCTCCTGGAAGCCCGTTGCAGG + Intronic
1133229820 16:4361191-4361213 ACCTCTTCCAGGCCCTCTGCGGG + Exonic
1134397270 16:13876716-13876738 TACTCATGGAAGCCCCATGCTGG - Intergenic
1138735522 16:59246708-59246730 TCCTGTTGCAAGCTCCTTGATGG - Intergenic
1139051551 16:63130045-63130067 TCCACCTGCAGTCCCCCTGCGGG + Intergenic
1139928837 16:70508599-70508621 TCATCCTGAAAGCCCACTGCTGG - Intronic
1141443272 16:84042841-84042863 GCCTCTCCCCAGCCCCCTGCAGG + Intergenic
1141577633 16:84974785-84974807 TCCACTTCCAAACCCCCTGCAGG + Intronic
1141830719 16:86508779-86508801 TCTGCGTGCGAGCCCCCTGCGGG + Intergenic
1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496633 17:309638-309660 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142902648 17:3022000-3022022 TGATCTAGCAATCCCCCTGCAGG - Intronic
1143332449 17:6147718-6147740 TCCTCATGCAAGCTGCCTCCAGG - Intergenic
1143337665 17:6185443-6185465 TCCTCTTCCAAGCCCTGTGTTGG - Intergenic
1144495374 17:15742105-15742127 GCCTCTTGCCAGCCCCATGAGGG - Intronic
1144671685 17:17136404-17136426 TCCTGCTGCCAGCTCCCTGCGGG + Exonic
1144944959 17:18965155-18965177 TCCCCTTGCAAGCCCCTCACTGG - Intronic
1145799937 17:27676504-27676526 CTCTCTTGCCAGCCCCCTGCAGG + Intergenic
1147668702 17:42164463-42164485 TCCTCTTTCAAGCCCCTCTCTGG - Intronic
1148463954 17:47853467-47853489 TCCTCCTCCAAGCTGCCTGCTGG + Intronic
1148667764 17:49387592-49387614 TCCTGTTCCCAGCCCCCTCCTGG + Intronic
1148778233 17:50107869-50107891 CCCTCTCGCCAGCCCCTTGCTGG + Intronic
1149497072 17:57125742-57125764 TCATCTTTGAAGCCCCCAGCAGG - Intergenic
1149866283 17:60152697-60152719 TCCTCCTTCAAGACCTCTGCGGG + Intronic
1152327171 17:79648238-79648260 TACTCTTGCCAGTCCCATGCTGG - Intergenic
1152662843 17:81550946-81550968 TCCTCCTACACGCCCCCAGCCGG - Exonic
1152713219 17:81885315-81885337 TTCTCTCACAAGCACCCTGCTGG + Intergenic
1157481891 18:48060481-48060503 TCCTCCTGCCTGCCTCCTGCTGG + Intronic
1157593651 18:48850994-48851016 CCCTCTTGCAAACGGCCTGCTGG - Intronic
1158238584 18:55350063-55350085 TTCTCTTGCAAGCCCTGTACAGG + Intronic
1160391987 18:78540771-78540793 TCCTTCTGCAGGCCCCATGCAGG - Intergenic
1160514781 18:79472263-79472285 CCCTCTAGGAAGCCCCCTCCAGG + Intronic
1161156666 19:2735407-2735429 TCCTCTTCCAAGCTCACTGGAGG + Intronic
1163529066 19:17839092-17839114 TGCTCATTAAAGCCCCCTGCAGG - Intronic
1165707670 19:37988018-37988040 TCCTCCTACAGTCCCCCTGCTGG + Intronic
1168307388 19:55442857-55442879 ACCCCCTGCAAGCCCCATGCCGG - Exonic
1168594622 19:57665107-57665129 TCCTCATGCAAAGCCGCTGCTGG + Intergenic
925820665 2:7796549-7796571 ACCTCTGGCAAACCCCATGCTGG - Intergenic
928430656 2:31215702-31215724 TCCTCTCCCAAGCCCACTCCTGG + Intronic
929385359 2:41400255-41400277 TCTTCTTTCCTGCCCCCTGCTGG + Intergenic
932701954 2:73998155-73998177 TCCTCTTGGAAGTCTTCTGCTGG + Intronic
933757155 2:85648793-85648815 GCCTCCTTCAAGCCCCCTGCTGG - Exonic
935371800 2:102355717-102355739 GCCGCTCGCAAGCACCCTGCAGG - Intronic
937247462 2:120502935-120502957 TCCTCTTGCCTGGCCTCTGCTGG + Intergenic
938226684 2:129622782-129622804 TCCTCTTGCTTCTCCCCTGCTGG - Intergenic
940322657 2:152392996-152393018 TCCTCTTTCAGGCCTCCAGCAGG + Intronic
944508468 2:200440263-200440285 TCCTCTTCCAAAAGCCCTGCTGG + Intronic
945335286 2:208584689-208584711 TGCTCCTGCAAGAGCCCTGCAGG - Intronic
946097662 2:217289681-217289703 TCCTCTCACAGGCCCCCTGGGGG + Intronic
946914188 2:224499652-224499674 TCCACTTATAAGCACCCTGCAGG + Intronic
947311736 2:228810281-228810303 TGTTCTAGCAATCCCCCTGCTGG - Intergenic
948575879 2:238949393-238949415 TCCCCCTGGAAGCCACCTGCAGG + Intergenic
1169491759 20:6077019-6077041 TCCTCATTCAAACCCACTGCTGG - Exonic
1169852587 20:10068754-10068776 TGATCTAGCAAGCCCACTGCTGG + Intergenic
1171175540 20:23048977-23048999 TCCACTTCCCAGCCACCTGCAGG - Exonic
1172105657 20:32515828-32515850 TTCTCTTGCCAGCAACCTGCTGG - Intronic
1172152787 20:32802228-32802250 TCCTCTAGCCAGCCTCCTGATGG + Intronic
1172208706 20:33182466-33182488 TACTCTTGCCAGCCTCCAGCAGG + Intergenic
1173049170 20:39542354-39542376 TCTTCTTGCCAGCACCCAGCTGG - Intergenic
1173655330 20:44696521-44696543 TCCTGATGCACGTCCCCTGCTGG - Intergenic
1173659631 20:44724532-44724554 TCTTCTTGCAATCCCTGTGCCGG + Intronic
1173874876 20:46364169-46364191 CCCTCCTGCAAGGCACCTGCCGG - Intronic
1175011859 20:55745585-55745607 TCCTCTTCCAAGCTCACTGGTGG - Intergenic
1175242101 20:57557179-57557201 TGCTCATACAAGGCCCCTGCAGG - Intergenic
1178788047 21:35672625-35672647 TCCTCTTCCAAGCCCACTGGTGG - Intronic
1182713418 22:32336504-32336526 GCATCTTACAAGCCCCCTCCTGG - Intergenic
1183672731 22:39282748-39282770 TCCTCTTGGCAGGGCCCTGCAGG + Intergenic
1184259764 22:43307940-43307962 TCTTCCTGCCAGCCCCCTTCTGG - Intronic
1184496904 22:44847207-44847229 CCCTCTGGCCAGGCCCCTGCTGG - Intronic
953627111 3:44580324-44580346 TCCTGCTGCCAGCTCCCTGCGGG - Intronic
954715255 3:52523720-52523742 TGCTCTGGCCAGCCCCCTCCTGG + Exonic
957211201 3:77260950-77260972 ACCTCTTGGAAGCCTCCTCCTGG + Intronic
960253800 3:115488577-115488599 TTGTCTTGCAAGCCCCCTTTAGG - Intergenic
960637171 3:119795292-119795314 CCCTCTTCCCATCCCCCTGCAGG - Intronic
961371427 3:126434135-126434157 TCCGCCTGCCAGCACCCTGCTGG + Intronic
964539185 3:157759837-157759859 GCTTCTGGCAAGGCCCCTGCAGG + Intergenic
967884781 3:194325915-194325937 TGCTCCTGCAAGCCCCCCACCGG + Intergenic
968001330 3:195208859-195208881 TCCTCTTGCAAGCCCCCTGCTGG - Intronic
970303066 4:14702115-14702137 TCCTCCTGCAAGCCCCTCCCAGG - Intergenic
970370578 4:15401523-15401545 CCCTCTTGCAATACCCATGCTGG - Intronic
973785841 4:54332125-54332147 TTCCCTTGCAAGCCCAGTGCTGG + Intergenic
975298881 4:72766269-72766291 TCCACCTGCAGACCCCCTGCGGG + Intergenic
976828032 4:89282035-89282057 TCTTCTTGCCAGCACCATGCAGG - Intronic
978761634 4:112359652-112359674 TCCTCCCCCAAGGCCCCTGCTGG - Intronic
978767425 4:112418545-112418567 TCCTCTGGCCAGGCCACTGCGGG - Intronic
983092640 4:163523026-163523048 TCCTGTTGCCAGCACCCTGATGG + Intergenic
985774125 5:1831802-1831824 TCCTCCTGCCAGCTCCTTGCTGG + Intergenic
994399423 5:99260579-99260601 TACTCTAGCAATCCCACTGCTGG + Intergenic
994507188 5:100657176-100657198 TCCACCTGCAGCCCCCCTGCAGG + Intergenic
994701990 5:103145373-103145395 TGATCTTGCAATCCCACTGCTGG + Intronic
998184582 5:139968558-139968580 TCCTCCTTCCAGTCCCCTGCAGG - Intronic
1000230408 5:159310550-159310572 TCCTTTTGCAAGCAGCCTGATGG + Intergenic
1000454573 5:161433782-161433804 TCCTATTGGAAGAACCCTGCAGG + Intronic
1003162583 6:3648966-3648988 TCATTTTGCAAGACACCTGCTGG - Intergenic
1007731868 6:43952221-43952243 TCCACTTGGAGGCCCCCTACAGG - Intergenic
1008654216 6:53594915-53594937 TCCTCTAACCAGCCCCCAGCTGG + Intronic
1015393664 6:132711861-132711883 TCCTCTTGCAGGCCCCCCTTTGG - Intronic
1015541436 6:134317874-134317896 TCCTCTCTCAAGCCGCCTCCAGG - Exonic
1017084115 6:150697698-150697720 TACTCTGGCCAGCCTCCTGCTGG + Intronic
1019311792 7:365796-365818 TCCTCATGCAGGCCCTCCGCCGG + Intergenic
1022340198 7:29460422-29460444 CCCTCTTAGAAGCTCCCTGCTGG - Intronic
1023602366 7:41892529-41892551 ACCTCTGACATGCCCCCTGCAGG + Intergenic
1029982364 7:104890804-104890826 TCCTCTTCATAGCCCCCTCCCGG - Intronic
1032495806 7:132361259-132361281 GCCTCTTCAAAGGCCCCTGCAGG + Intronic
1032707481 7:134433767-134433789 TCCTTTTGCAACCCTTCTGCAGG + Intergenic
1032992684 7:137411233-137411255 TGCCCCTGCAAACCCCCTGCTGG - Intronic
1034505804 7:151489921-151489943 TTCTCTTGCAAGCCTCCGGCCGG + Intronic
1035896562 8:3409365-3409387 TCCCCTTGCAAGATCCTTGCAGG + Intronic
1035903754 8:3486852-3486874 TCCTCTTCCAAGAACCCTGTTGG - Intronic
1036805986 8:11834163-11834185 TCCTCTGGCAAGTCCCTTCCAGG - Intronic
1039471061 8:37814128-37814150 TTCTCTGCCAAGCTCCCTGCTGG - Intronic
1042454865 8:68989363-68989385 GCCACTTGCATGCCTCCTGCAGG - Intergenic
1043670913 8:82883036-82883058 TCCTCCTGCAATTCCCCTGTTGG - Intergenic
1046621278 8:116531458-116531480 TCCACCTGCAGGCCCCGTGCGGG + Intergenic
1049277153 8:141725596-141725618 GAGTCTTGCAAGCTCCCTGCAGG + Intergenic
1049494057 8:142921512-142921534 TCCTCTTCCAGGCCCTATGCTGG + Intergenic
1049519081 8:143079155-143079177 ACCTCCTGCAAGACCCCTGAGGG + Intergenic
1049764880 8:144350498-144350520 TCCTCTTGCAAGCTGCCCCCTGG + Intergenic
1052896268 9:33750742-33750764 TCCAGTTTCAAGCCCCCTGCGGG - Intronic
1053343752 9:37362594-37362616 TCTCCCTGCAAGGCCCCTGCAGG - Intergenic
1054831751 9:69632961-69632983 TCCTCTAGCTCCCCCCCTGCTGG + Intronic
1054904132 9:70400094-70400116 TCCTCTTGGAAGCCCCACACAGG + Intronic
1054979201 9:71184277-71184299 TGTTCTTGCAACCCCCATGCTGG - Intronic
1055464434 9:76550232-76550254 CTCTCTTGCTATCCCCCTGCTGG + Intergenic
1056795303 9:89655037-89655059 GCCACTGGCTAGCCCCCTGCGGG + Intergenic
1057307497 9:93920713-93920735 TCCTCTTCCAAGCCCCCTCCAGG + Intergenic
1057809941 9:98250119-98250141 TCTTCTTGCCAGCCTCCTCCTGG - Intronic
1057836475 9:98449377-98449399 TCCTCTAGCAAGCCCCGCACTGG - Intronic
1060876940 9:127090423-127090445 TCCTCTTCCAGGGCCCCTTCGGG + Intronic
1061665497 9:132158669-132158691 TCCTCTTGGAAGTCCCCAGAGGG + Intergenic
1062024826 9:134335539-134335561 TCCTCTGGCCTGCCCCTTGCTGG + Intronic
1062036758 9:134385903-134385925 TCCTCTGCCCAGGCCCCTGCTGG + Intronic
1062161881 9:135085113-135085135 TCCTCATGCCAGCCCCCTACAGG - Intronic
1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG + Intronic
1062645080 9:137543749-137543771 TCCTCTTCCTGGCCCGCTGCCGG + Exonic
1186656304 X:11615332-11615354 TACTCTTGCAAGCACTCTGAGGG + Intronic
1186692992 X:11999143-11999165 CCATCTTCCAAGCCCCCTCCAGG - Intergenic
1191016239 X:55813318-55813340 CCCTGTTTCCAGCCCCCTGCTGG - Intergenic
1192246883 X:69380078-69380100 TCCTCTTGCCAGCCCCTGCCTGG - Intergenic
1192561200 X:72129245-72129267 TCCTCTTCCAGGCCCTCTGCTGG + Exonic
1193696150 X:84709220-84709242 TCCACATGCAAACCCCTTGCAGG - Intergenic
1194364979 X:93003734-93003756 TCCTGTTGCAAGTCCCTTGAGGG + Intergenic
1197262538 X:124333731-124333753 TCCTCCTGGAAGCCCACTGCAGG - Intronic
1200132184 X:153856443-153856465 TCCTCTTGCAAGGCACCAGAGGG + Intergenic