ID: 968003016

View in Genome Browser
Species Human (GRCh38)
Location 3:195220596-195220618
Sequence GGTCTGAGCAGGCTGAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968003016_968003023 4 Left 968003016 3:195220596-195220618 CCCCCTTTCAGCCTGCTCAGACC 0: 1
1: 0
2: 2
3: 26
4: 247
Right 968003023 3:195220623-195220645 TGCCTCAGTGCTCCCTACACTGG 0: 1
1: 0
2: 0
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968003016 Original CRISPR GGTCTGAGCAGGCTGAAAGG GGG (reversed) Intronic
901128086 1:6943273-6943295 GCCCTGAGGAGGCTGAGAGGAGG - Intronic
902695096 1:18134803-18134825 GGTCTGAGCAGGTTGAGTCGGGG - Intronic
903156095 1:21444827-21444849 GGGAAGAGCAGGTTGAAAGGTGG - Intronic
903711299 1:25326727-25326749 TGTGTGAAAAGGCTGAAAGGTGG + Intronic
903715649 1:25364702-25364724 TGTGTGAAAAGGCTGAAAGGTGG - Intronic
904033954 1:27549368-27549390 GGACAGGACAGGCTGAAAGGAGG + Exonic
905035700 1:34917038-34917060 GGTCTGAGGAGGCCAATAGGTGG + Intronic
905297486 1:36963320-36963342 GGTCTCAGGAGGCTGAGCGGGGG - Intronic
906153268 1:43600098-43600120 GCACTGGGCAGGCTGAGAGGGGG - Intronic
907083802 1:51649985-51650007 GCTCTCAGGAGGCTGAGAGGTGG - Intronic
907188705 1:52631874-52631896 GGTCTGAGCAGACTGGGAGCTGG - Intergenic
911222281 1:95261760-95261782 GTTCTGGGGAGGCGGAAAGGTGG - Intergenic
913067570 1:115270508-115270530 GGACTGAGTAGCATGAAAGGAGG - Intergenic
913456202 1:119033654-119033676 GTTCTGAGCACGCTGAAGGTGGG + Intronic
913600748 1:120419729-120419751 GGGAGGAGCAGGTTGAAAGGTGG - Intergenic
913993462 1:143635879-143635901 GGGAGGAGCAGGTTGAAAGGTGG + Intergenic
914086309 1:144456904-144456926 GGGAGGAGCAGGTTGAAAGGTGG + Intronic
914192203 1:145420855-145420877 GGGAGGAGCAGGTTGAAAGGTGG + Intergenic
914361890 1:146943170-146943192 GGCAGGAGCAGGTTGAAAGGTGG - Intronic
914420212 1:147522164-147522186 GGTCTGTGAAGGCTGAAAGAAGG - Intergenic
914590110 1:149098805-149098827 GGGAGGAGCAGGTTGAAAGGTGG + Intronic
915610299 1:156986491-156986513 GGTCTTACCAGGCTGCAATGGGG + Intronic
915745312 1:158151867-158151889 GGTCTGTGCAGGCAGTAAGTGGG + Intergenic
916262268 1:162854200-162854222 GATATGAGCAGGTTGAAAGTGGG + Intronic
917533528 1:175857606-175857628 GGTCTGGGCGGGCTAAAAAGTGG + Intergenic
918355048 1:183700114-183700136 GGTCTGAGCAGGTTGAGGGTAGG - Intronic
919444363 1:197683374-197683396 AGTGTGAGAAGGCTGAAAAGGGG + Intronic
919534850 1:198774745-198774767 GGTCAGAATAGGCTGAAAGGAGG - Intergenic
919918290 1:202152645-202152667 GGTCTGGCCAGGCCGAAAAGAGG + Exonic
919929984 1:202214754-202214776 GGTCTGGAGAGGCGGAAAGGTGG + Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920823081 1:209399646-209399668 GATCTGAGAAGGTTGGAAGGAGG + Intergenic
922228703 1:223667369-223667391 GGTCTGAGCAAGTAGAAAGAAGG + Intergenic
922802513 1:228370855-228370877 CCTTTGAGCATGCTGAAAGGAGG + Intronic
1062790826 10:304437-304459 GGTCTTAGCAGACTGAGAGCTGG - Intronic
1065513786 10:26505443-26505465 GGACTGAGCAGGAGGAAAGTTGG - Intronic
1067220716 10:44342199-44342221 AGTCTGAACAGGATGAAAGGGGG - Intergenic
1067724501 10:48759661-48759683 GGTCTGAGGAGCAGGAAAGGAGG - Intronic
1070404205 10:76080212-76080234 GGTCTGGGAATTCTGAAAGGGGG - Intronic
1070799102 10:79234748-79234770 GGCCGGAGTAGGCTGACAGGTGG - Intronic
1070962910 10:80511484-80511506 TGTCTGAGGAGGCTGGAAGGAGG + Intronic
1070987560 10:80701371-80701393 GGTCTGAGGGAGCTGAGAGGTGG + Intergenic
1071215832 10:83400304-83400326 AGTCTGTGGAGGCAGAAAGGAGG + Intergenic
1071730459 10:88243526-88243548 GTGCTGAGCAGACAGAAAGGAGG - Intergenic
1072139131 10:92574215-92574237 GGCCTGAGCAGGCGGACTGGAGG + Intergenic
1072298440 10:94035561-94035583 GGTCTGAGCAGGCTTGGAGGAGG + Intronic
1073108001 10:101043570-101043592 GGTCTGAGAAGACAGGAAGGAGG - Intergenic
1073419986 10:103416864-103416886 GGTGTGAGCCGGCTAAATGGAGG + Intronic
1073511315 10:104044289-104044311 GGGCTGTGCAGGATTAAAGGGGG + Intronic
1074762376 10:116676599-116676621 CTTCTTAGCAGGCAGAAAGGGGG + Intronic
1076690215 10:132219862-132219884 GGTCTGAGGAGGCTGCACGGGGG + Intronic
1076737402 10:132464991-132465013 GGCCTGGGAAGGCTGAAAGAAGG + Intergenic
1077411811 11:2407181-2407203 TGGCTGAGCAGGATGAAGGGCGG + Exonic
1078085120 11:8229365-8229387 GGTCTGGGCATGTTGCAAGGGGG - Intronic
1078087853 11:8244896-8244918 GGTCAGAGCAGGCTTTAAGGAGG - Intronic
1078436983 11:11333583-11333605 GGTCCGAGGAGGCAGAAGGGTGG - Intronic
1079124686 11:17710009-17710031 GGACTGATGAGGCAGAAAGGAGG + Intergenic
1082215265 11:49560860-49560882 GTTCTGAGCACGCTGAGCGGAGG + Intergenic
1082635590 11:55589367-55589389 ATTCTGAACAGGCTGGAAGGAGG - Intergenic
1083200518 11:61118560-61118582 GGTCTGAGCAGGCTGGTGGAAGG + Intronic
1083292303 11:61696824-61696846 GGACTGAGCAGACAGAAATGTGG + Intronic
1083682701 11:64358773-64358795 GTGCTGGGCAGGCTGAGAGGGGG - Intergenic
1088262043 11:107953495-107953517 GGGGTGAGCAGGCAGAAAGGGGG - Intronic
1091671385 12:2454470-2454492 CGTCTGAGCTGGCTGGAAGGAGG - Intronic
1093619015 12:21264996-21265018 GGTCTGAGCAGGAGGACATGAGG + Exonic
1098097400 12:66973419-66973441 GGTTTTAACAGGCTGAAAGAGGG - Intergenic
1101996018 12:109525266-109525288 GCTCTGAGAAGCCTGTAAGGAGG + Intronic
1101999113 12:109545624-109545646 GGTTTGAGCAGGCAGAAGAGGGG + Intergenic
1103929977 12:124444998-124445020 GGGCTGTGCAGGCGGAAAGGGGG - Intronic
1104045561 12:125160239-125160261 GGTCTGACCAGGCTGGAGGAAGG + Intergenic
1104231016 12:126884043-126884065 TGTCTGAGCTGGCAGAAAGCAGG + Intergenic
1104521101 12:129476112-129476134 GGTATGAGCAGACAGAAAGCAGG - Intronic
1108774129 13:53743318-53743340 GGTCTGAGCAGAGAGAATGGAGG + Intergenic
1109125278 13:58509822-58509844 TGTTTGAGGAGGCTGAAAGTAGG + Intergenic
1111319950 13:86614313-86614335 AGTCTGAGCAGGGTGACAGTGGG + Intergenic
1111517215 13:89350461-89350483 GGTATGAGCAGGGTAAGAGGGGG + Intergenic
1111736141 13:92141719-92141741 GGTCTCACAAGGCTGAAAGCAGG + Intronic
1112354118 13:98660309-98660331 GGGAAGAGCAGGCTGGAAGGAGG + Intergenic
1113135500 13:107084443-107084465 GTTCTGTGCAACCTGAAAGGAGG - Intergenic
1114259176 14:21025182-21025204 AGTCTGGGCGGGGTGAAAGGGGG - Intronic
1114675663 14:24438711-24438733 GGTATGACCAGCCTCAAAGGTGG - Exonic
1117930914 14:60839390-60839412 GCTCTGAGGAGACTGGAAGGGGG - Intronic
1119623028 14:76147171-76147193 GGCCTGAGCAGGCTGCAAGCAGG - Intergenic
1121320329 14:92988239-92988261 GGTCTGGGCAGGCTGACACTGGG + Intronic
1122122947 14:99564301-99564323 GGTCTGGGGAGGGTGCAAGGAGG - Intronic
1122174598 14:99907804-99907826 GGAATGAGCCCGCTGAAAGGGGG - Intronic
1122938568 14:104971029-104971051 GGGCTGAGCGGGCTGAAGGGAGG - Intronic
1123809864 15:23913131-23913153 GGTCTGTGCATTCAGAAAGGTGG - Intergenic
1126732646 15:51699892-51699914 GGGCTGAGTAGGGTGATAGGTGG - Intronic
1126758434 15:51947083-51947105 GGTCTTAGAAGGCTGCATGGAGG - Intronic
1126856572 15:52845193-52845215 GGGCTGAGCAGGGTGGCAGGAGG - Intergenic
1127384454 15:58456031-58456053 GGTCTGAGAAGGCTTCATGGGGG + Intronic
1129645310 15:77424676-77424698 TGTGTGAGCATGCTGATAGGGGG - Intronic
1129766812 15:78174758-78174780 TGTCTGAGCAGGCTGAGTCGTGG - Intronic
1131636948 15:94246006-94246028 GGTCTGTGTAGGCTGAGAGTGGG + Intronic
1132243050 15:100275697-100275719 GGTATGAGAAGGCAGTAAGGTGG + Intronic
1132809764 16:1791927-1791949 CGTCTGAGCAGGCTGGAGGACGG - Exonic
1134189522 16:12110489-12110511 GGGCTCAGCAGGCCAAAAGGTGG - Intronic
1134391894 16:13827713-13827735 GGTCGGAGGAGGGTGAGAGGAGG - Intergenic
1135743859 16:24998906-24998928 GGAAAGAGGAGGCTGAAAGGAGG + Intronic
1135752507 16:25068394-25068416 GGAAAGAGGAGGCTGAAAGGAGG - Intergenic
1138217626 16:55218412-55218434 GGACTGAGTAGGCTTCAAGGAGG + Intergenic
1141213652 16:82004287-82004309 GATCTAGGTAGGCTGAAAGGAGG + Intronic
1141571193 16:84934548-84934570 GGTCTGGGCTGGCTGGAGGGAGG - Intergenic
1141611833 16:85185940-85185962 GGCCTGAGCAGGGTGATGGGTGG + Intergenic
1142186557 16:88697589-88697611 GGCCAGAGCAGCCTGGAAGGCGG + Exonic
1142256926 16:89018438-89018460 GGTCTGGGCTGAATGAAAGGGGG + Intergenic
1143145075 17:4769984-4770006 GGTCTGAGTGGGCCGCAAGGAGG + Intergenic
1143682376 17:8486992-8487014 GGTGTGAGCAGGCAGGCAGGGGG - Intronic
1145289042 17:21528556-21528578 GGTGTGTGCAGCCGGAAAGGGGG - Exonic
1146827235 17:36033412-36033434 GGAAGGAGAAGGCTGAAAGGAGG - Intergenic
1147743061 17:42679588-42679610 GAGCTGAGCAGGAAGAAAGGCGG + Exonic
1147976842 17:44252905-44252927 CGTCTGAGCAGGGAGGAAGGGGG - Intronic
1148797659 17:50204794-50204816 GGTCTGAGGAGACAGAAGGGCGG + Intergenic
1152206611 17:78977681-78977703 GGTCTCAGCAGGCAGAGACGAGG + Intronic
1153348774 18:4056257-4056279 GGTTTGGGCAGGCTGATGGGTGG + Intronic
1156715490 18:40003949-40003971 GGACTCAGCAGGCTGAAAACAGG + Intergenic
1157425942 18:47584359-47584381 GATCTGGGCAGGCTGCAAGGAGG + Intergenic
1157666611 18:49492550-49492572 GATCTGAGGAGGCAGGAAGGCGG + Exonic
1158516834 18:58137930-58137952 GGTCTGAGCACACTGAAAAGAGG - Intronic
1160396119 18:78573359-78573381 GGCCTGAGCAGGATGAAGGGGGG - Intergenic
1160409274 18:78664085-78664107 GGTGTGAGCAGCCTCAGAGGTGG + Intergenic
1161665904 19:5576694-5576716 GGTCGGATCATGCTAAAAGGAGG - Intergenic
1162714370 19:12620573-12620595 GGTCTGAGCAGGAAGAAATTTGG - Intronic
1162793671 19:13075820-13075842 GGGCAGAGCAGGCTGAAGGAAGG + Intronic
1163250335 19:16122970-16122992 GGTCAGGGCAGGGTGGAAGGTGG - Intronic
1163691695 19:18742013-18742035 GGGCTGGGCAGGCAGGAAGGAGG - Intronic
1163831628 19:19549805-19549827 GGTCTGGGCAGGCAGGAGGGAGG + Intergenic
1164906523 19:31972802-31972824 AGTCTGTGCAGGCTGGAAGCTGG - Intergenic
1165585917 19:36915866-36915888 GGGCGGAGCGGCCTGAAAGGTGG - Exonic
1166570932 19:43796944-43796966 AGTCTCTGCAGGCTGAATGGTGG + Exonic
1166570955 19:43797108-43797130 GGTCTCTGCAGGCTGAATGGTGG + Exonic
1167473372 19:49687314-49687336 GGTCTGAGCAGGCAGGAGGATGG + Intronic
1168103649 19:54153933-54153955 GGACTGCGCCAGCTGAAAGGTGG - Intronic
926329838 2:11815265-11815287 GGTCTGAACAGGCTCACAGATGG - Intronic
926715224 2:15919038-15919060 CGTCTTGGCAGGCTGAGAGGAGG + Intergenic
927724033 2:25406929-25406951 GGTCTGAGCAGGTTAAAAATTGG + Intronic
933701976 2:85262070-85262092 GGTCGGATCATGCTAAAAGGAGG - Intronic
933898761 2:86834564-86834586 CGTCTGACCAGGCTCAAACGTGG + Intronic
934814849 2:97315580-97315602 GGTCTGAGCAGCCTGTAGGAAGG - Intergenic
934822846 2:97392903-97392925 GGTCTGAGCAGCCTGTAGGAAGG + Intergenic
935781781 2:106514655-106514677 CGTCTGACCAGGCTCAAACGTGG - Intergenic
937322116 2:120967038-120967060 GGTCTGAGCAGGCAGAAGGGAGG + Intronic
937404819 2:121617257-121617279 GGTCTGAGGAGGCAGAAAGGAGG - Intronic
937867175 2:126761254-126761276 GGTTTGAGCAGGCTGGGATGAGG - Intergenic
938072165 2:128314501-128314523 CATCTGAGCAGACTGAAGGGAGG + Intronic
938449461 2:131404244-131404266 GATCTGAGCAGGCTGAACTAAGG - Intergenic
938801980 2:134772100-134772122 GGTCTGAGCAGTTGGAAAGATGG + Intergenic
940024562 2:149192498-149192520 GGTCAAAGCATGGTGAAAGGTGG + Intronic
942454087 2:176125651-176125673 GGCCTGAGCTGGGTGGAAGGTGG + Intergenic
946767040 2:223050460-223050482 GCTTTGAGTAGGCAGAAAGGAGG - Intergenic
947024729 2:225724407-225724429 GGTCTGAATAGGTTGAAATGTGG + Intergenic
947588538 2:231371417-231371439 CTTCTGAGCCGGCTGAAAGAGGG + Intronic
948881462 2:240859639-240859661 GGATGGAGCAGACTGAAAGGGGG - Intergenic
949044879 2:241867850-241867872 GGGCTGAGGAGCCTGAGAGGTGG + Intergenic
1170421616 20:16199282-16199304 GGTCTCACCAGGCTGAAATTAGG + Intergenic
1170566627 20:17611511-17611533 GGTCTGTGCATGCAGAAGGGAGG - Intergenic
1171324752 20:24281608-24281630 GGTCTGAGGAGACTCCAAGGAGG + Intergenic
1172713256 20:36943761-36943783 GGACTGAGAGGGCTGAAATGTGG + Intronic
1173669313 20:44786733-44786755 GGCCTAAGCTGGCAGAAAGGAGG + Intronic
1175417613 20:58812030-58812052 GGTCTAAGCAGCCTGGAAGGTGG - Intergenic
1175742928 20:61433324-61433346 CGTCAGAGCAGGGTGACAGGAGG - Intronic
1176932375 21:14829068-14829090 GATCTGAGCAGGCTGAAGCCTGG + Intergenic
1178926019 21:36775663-36775685 GATCTGAACAGCCTGAAAAGGGG - Intronic
1178928411 21:36794899-36794921 GGGCTGAGCAGGCTGGAGGGTGG + Intronic
1180103543 21:45601713-45601735 GGTCTGAGCAGCCCTAGAGGAGG + Intergenic
1180796181 22:18606851-18606873 GGACAGAGCAGACTGATAGGAGG - Exonic
1181150204 22:20877846-20877868 GAGATGTGCAGGCTGAAAGGTGG + Intronic
1181225541 22:21388420-21388442 GGACAGAGCAGACTGATAGGAGG + Exonic
1181253092 22:21546393-21546415 GGACAGAGCAGACTGATAGGAGG - Exonic
1182218085 22:28736090-28736112 GTTCTGAGCATGTTTAAAGGAGG + Intronic
1183654200 22:39175606-39175628 GCTCTGAGAAAGCTGAAGGGGGG - Intergenic
1184116806 22:42427037-42427059 GGTCTGAGCAGGCTGGATTTGGG - Intronic
1184645044 22:45891030-45891052 GGTCGGAGCAGGGAGGAAGGCGG - Intergenic
1184689334 22:46110351-46110373 GGTCCCAGCAGGCTAAAAAGGGG - Intronic
950463591 3:13140119-13140141 TGTCTGAGCGGGTTGGAAGGAGG - Intergenic
952206560 3:31186202-31186224 GGTCTCAGAAAGCTGAAACGAGG - Intergenic
952355049 3:32576273-32576295 GGGCTGATGTGGCTGAAAGGGGG - Intergenic
955016444 3:55074930-55074952 GGTCTGAGGAGACTTGAAGGAGG + Intergenic
955112682 3:55964711-55964733 GGTCTTACCAGGCTGAAATCAGG + Intronic
959305751 3:104663894-104663916 GGGCTGAGGAGGTTGAAGGGAGG + Intergenic
960220368 3:115100849-115100871 AGTCAGAGCAGTCTTAAAGGAGG + Intronic
961317811 3:126052462-126052484 GGGTGGCGCAGGCTGAAAGGAGG - Intronic
961926284 3:130484557-130484579 GGTCATAGCAGCCTGACAGGTGG - Exonic
962167049 3:133060254-133060276 GGTCTGAGAAGGCTGTTATGAGG + Intronic
962810475 3:138955238-138955260 GGTCTGAGCAGGGAGAGAGCAGG + Intergenic
963467879 3:145705121-145705143 GGCCTGATCAGGCAGAATGGTGG + Intergenic
964305030 3:155330485-155330507 TGTCTGAGCAGGCTCAGAGGAGG + Intergenic
965823722 3:172710218-172710240 AGGCTGGGCTGGCTGAAAGGAGG - Intronic
966712077 3:182980875-182980897 GGTCTACGCAGGCTGGAAGCGGG + Intronic
968003016 3:195220596-195220618 GGTCTGAGCAGGCTGAAAGGGGG - Intronic
968439266 4:613332-613354 GGTCTGAGCAGGCACCATGGTGG - Intergenic
968555440 4:1244448-1244470 GGTCTGAGCAGGCGGGGATGAGG - Intronic
979081979 4:116356846-116356868 TGCCTGGGCAGGCTGAAAGGTGG - Intergenic
979274468 4:118799647-118799669 GGACTGAGAAGGATGAAACGAGG + Intronic
982072020 4:151704119-151704141 AGTTTGAGCTGGCTGAAAGATGG - Intronic
984193060 4:176627247-176627269 GGACTGGGCAGGCTGGAAGAGGG + Intergenic
985275550 4:188234170-188234192 GGTCTCACCAGGCTGAAATCAGG - Intergenic
986531474 5:8740828-8740850 GGTCTGTGCAGGCTCACAGGTGG + Intergenic
987141788 5:14953825-14953847 GATCAGAGGAGGATGAAAGGGGG - Intergenic
990042589 5:51390963-51390985 GGTCTGAGAAGGCAGAGGGGAGG + Intronic
990521909 5:56588942-56588964 GGTGTGTGGAGGCTGAAATGTGG - Intronic
990847069 5:60153850-60153872 GGTCTGAGGAGGGGGAAATGAGG + Intronic
991151392 5:63375573-63375595 TGTCTGAGAGGGCTGCAAGGAGG + Intergenic
991375288 5:65958875-65958897 GTTCTGAGCATGCTTAAAGTAGG + Intronic
992323917 5:75641948-75641970 GGTAGGAGAAGGCTGAAAGAAGG + Intronic
994248541 5:97509631-97509653 GCTCTTAGGAGGCAGAAAGGAGG + Intergenic
994593883 5:101806885-101806907 TGTTTGTGCAGGCTGAAAGTGGG + Intergenic
996796109 5:127350269-127350291 GCCTTGGGCAGGCTGAAAGGTGG - Intronic
997282390 5:132656977-132656999 AGCCTGAGCAGGCAGAGAGGGGG + Intronic
997400792 5:133600268-133600290 GTTCTGAGCATGCTGAAGGCAGG + Intronic
999036087 5:148351406-148351428 GGTAGGAGCAGGTTGAGAGGAGG + Intergenic
999148752 5:149412947-149412969 GCTCTGGGCAGGCTGACCGGGGG - Intergenic
999955153 5:156692968-156692990 GCTCTGAGGAGGATAAAAGGAGG - Intronic
1000414103 5:160965353-160965375 GGCCAGAGCAGGAGGAAAGGGGG - Intergenic
1000567478 5:162867676-162867698 GGCCTGAGCAGGAGGAATGGTGG - Intergenic
1001485854 5:172119179-172119201 GGTCTGAGCAGGCAGGGAGCGGG + Intronic
1003927364 6:10888615-10888637 GGCCAGAGAAGGTTGAAAGGAGG + Intronic
1004463128 6:15857624-15857646 GGTGGGAGAAGGCTGAAAGATGG + Intergenic
1006122255 6:31814698-31814720 GGTCGGAGCAGCCAGAATGGGGG - Intronic
1006153395 6:32001266-32001288 GGACTGAGGAGGCAGAATGGAGG + Intronic
1006159703 6:32034003-32034025 GGACTGAGGAGGCAGAATGGAGG + Intronic
1007996709 6:46315547-46315569 GGTTAGAGCAGAGTGAAAGGGGG + Intronic
1009703398 6:67213142-67213164 GGCCTGAGCAGCAGGAAAGGGGG + Intergenic
1013746661 6:113353921-113353943 GGTCTCAGCAGGCTGAATGAAGG - Intergenic
1014532077 6:122570269-122570291 GGTTTTATCAGGTTGAAAGGTGG - Intronic
1014816536 6:125942013-125942035 GGTCTCAGGAGGCTGAGAAGTGG - Intergenic
1016845821 6:148567412-148567434 GGTCAGATCATGCTAAAAGGAGG - Intergenic
1017009915 6:150056414-150056436 GAACTGAGCAGGTTGAGAGGAGG - Intergenic
1017249815 6:152267826-152267848 AGGCTGCGCAGGCTGGAAGGAGG + Intronic
1017608592 6:156159729-156159751 ATGTTGAGCAGGCTGAAAGGAGG + Intergenic
1017767991 6:157622697-157622719 GTTCTGAGAAGGCTGAGAGCTGG - Intronic
1017841450 6:158225948-158225970 GCTCTGAGCAGGCTGGGAAGGGG + Intergenic
1017972815 6:159327820-159327842 GGTCTGGGCAGGGTGCAAGAGGG + Intergenic
1018015856 6:159711975-159711997 GGTCTGAGCAGTGTGAGTGGTGG - Intronic
1018015863 6:159712017-159712039 GGTCTGAGCAGTGTGAGTGGTGG - Intronic
1018015933 6:159712433-159712455 GGTCTGAGCAGTGTGAGTGGTGG - Intronic
1018638504 6:165885642-165885664 GCTCAGCGCTGGCTGAAAGGTGG + Intronic
1018706983 6:166470421-166470443 TGTCTGAGCAGGCTCAGGGGTGG - Intronic
1018849847 6:167578968-167578990 GGTGGGAGCAGGCGGAAGGGAGG + Intergenic
1019182927 6:170203128-170203150 GGTCTGCACAAGCTGGAAGGAGG + Intergenic
1022822911 7:33978771-33978793 GTTCTGAGCAGGCTGAAGACAGG - Intronic
1023282149 7:38581836-38581858 GGACTGAGCAACCTGAAAGATGG + Intronic
1023991216 7:45129995-45130017 GGGCTGAGCCGGCTGGAAGGGGG - Intergenic
1026100183 7:67378151-67378173 GGTGTCCTCAGGCTGAAAGGTGG - Intergenic
1026392191 7:69912647-69912669 GGTCTGCTCAGTTTGAAAGGGGG - Intronic
1027345449 7:77255022-77255044 GGTCTGAGCTGGCCGAATTGGGG + Intronic
1029362784 7:100099488-100099510 TTTCTGAGCAGGCAGAAAGGAGG - Intronic
1029644312 7:101843719-101843741 GATCTCAACAGGCTGAAGGGAGG - Intronic
1031018916 7:116605422-116605444 GTTCTGAGCAGGTTTAAAGTAGG - Intergenic
1033134614 7:138774078-138774100 GGGCTGAGCAGGCTGGCCGGTGG - Intronic
1035549978 8:514813-514835 GGTGGGAGGAGGCTGAGAGGTGG - Intronic
1038017892 8:23530059-23530081 GTTCTGGGCAGGCTGACAGAGGG - Intronic
1038333525 8:26628448-26628470 GGCCTGTGCTGGCTCAAAGGTGG + Intronic
1038696031 8:29807231-29807253 GGTCTGAGCAGGCTGGCAATAGG + Intergenic
1039627799 8:39072669-39072691 GAACTGAGCAGGCTGAGAGGGGG - Intronic
1042067854 8:64898635-64898657 GGTCTGAGAGGTCTGAGAGGTGG - Intergenic
1044526784 8:93261326-93261348 GTGCTGAGCAGGCTGAAAACAGG - Intergenic
1044537264 8:93371459-93371481 AGGCTGAGCAGGCCAAAAGGTGG + Intergenic
1044920176 8:97161972-97161994 GGTCTGAGTTGGCTGAAGAGAGG - Intergenic
1045102843 8:98862700-98862722 GAACTGAGAAGGCAGAAAGGAGG + Intronic
1048630884 8:136241010-136241032 GGTCTGTGCAGTCTAAAAGCAGG + Intergenic
1049311583 8:141936498-141936520 GGTCTGAGCAGAGAGCAAGGTGG + Intergenic
1049592001 8:143466841-143466863 GCTCTGAGCAGGCTGGGAAGGGG - Intronic
1049812103 8:144580217-144580239 GGTCTGAGCAGGCTTGGAGGTGG - Intronic
1057336848 9:94162354-94162376 GCTGTGAGCAGGATGGAAGGGGG - Intergenic
1058674113 9:107386148-107386170 GGGCTGAGCAGGATGAATTGAGG + Intergenic
1061042858 9:128149848-128149870 AGTCTGTTCAGGCTGAGAGGGGG - Intronic
1062009385 9:134258992-134259014 GGACTGAGCAGGCAGGAAGCTGG + Intergenic
1062181865 9:135195241-135195263 GGTCTGAGCAGGGCGGGAGGAGG + Intergenic
1062366709 9:136213127-136213149 GATCAGAGCAGACGGAAAGGGGG + Intronic
1187355636 X:18567938-18567960 GTTCTGAGCATGTTTAAAGGAGG - Intronic
1190507449 X:51140054-51140076 GGTCTGTGCATTCTGAAAAGTGG - Intergenic
1193214653 X:78849346-78849368 GGTCTGAACTGGATGAAAAGGGG + Intergenic
1195477680 X:105304991-105305013 GGCCAGAGCAGGAGGAAAGGGGG + Intronic
1198271662 X:135061411-135061433 GGACTGAGGAGGCTCCAAGGGGG - Intergenic