ID: 968004808

View in Genome Browser
Species Human (GRCh38)
Location 3:195235215-195235237
Sequence GAAAATACACAGTTAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968004808 Original CRISPR GAAAATACACAGTTAGAGCT GGG (reversed) Intronic
902291680 1:15439621-15439643 GTAAATCCACTGTTATAGCTGGG - Intronic
902825848 1:18973696-18973718 AAGAACACACAGTTAGAACTAGG - Intergenic
905591640 1:39168921-39168943 GAAAATACTGAGTTTGGGCTGGG - Intronic
906388806 1:45395799-45395821 GATAAAACATAGTTAAAGCTTGG - Intronic
911720598 1:101187119-101187141 GAAAAGAGTCAGATAGAGCTGGG - Intergenic
911756366 1:101561200-101561222 AAAAGTACACAGAAAGAGCTGGG - Intergenic
912362059 1:109103367-109103389 GAAACTACACAGTTGGATCATGG + Intergenic
912810017 1:112786999-112787021 AAAAATACAAAATTAGAGCTCGG + Intergenic
914252070 1:145929723-145929745 GGAAATACACAGTTAAAGACAGG - Intergenic
916193825 1:162204547-162204569 CACAGTTCACAGTTAGAGCTGGG + Intronic
917874918 1:179277619-179277641 GAAAATACAAATATAGGGCTGGG - Intergenic
918887806 1:190219542-190219564 GAAAATACATAGTCAGGGCCAGG + Intronic
919683461 1:200458785-200458807 GAAAATACTCAGCTGGATCTAGG + Intergenic
920750333 1:208668800-208668822 GATAATACACAGTCAGTGGTCGG - Intergenic
921722496 1:218488870-218488892 GAACATACACATTTAGAGTGGGG - Intergenic
923549802 1:234954551-234954573 GAAAATCCAGAGTTTTAGCTCGG - Intergenic
923623020 1:235593295-235593317 GTAAATACAAAGTTGGGGCTGGG + Intronic
1063011059 10:2021973-2021995 GAAAATACAGGGTTAGCACTTGG + Intergenic
1063306827 10:4910114-4910136 GAATATAAACAGTGACAGCTGGG - Intergenic
1063651838 10:7945835-7945857 GAAAATTCACAGTAAGTGCTAGG - Intronic
1063978702 10:11436946-11436968 GAAAACACAAACTTAGGGCTTGG - Intergenic
1064163133 10:12962930-12962952 GAAAACACACACATAAAGCTTGG - Intronic
1064404048 10:15045377-15045399 AAAAATAGGCAGTCAGAGCTGGG - Intronic
1068520189 10:58069060-58069082 GAAAATAAACAGTTGGAGATGGG - Intergenic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1069014569 10:63414278-63414300 GAAAATACACAGTATTGGCTGGG - Intronic
1069144228 10:64869022-64869044 TAAAATATACTGTTAGTGCTGGG - Intergenic
1070193569 10:74134525-74134547 GAGAATACAGAGTTATAACTAGG + Intronic
1070201496 10:74210032-74210054 GAAAATACTCAGTTTTGGCTGGG + Intronic
1071215509 10:83396029-83396051 GAAAAAAAACAGAGAGAGCTGGG + Intergenic
1071791122 10:88955406-88955428 GAGAAGACACAGTGAGAGCAAGG + Intronic
1072900865 10:99405211-99405233 GAATATACACACTTTCAGCTAGG + Intronic
1073020022 10:100435408-100435430 GAAAATAAACATTTATGGCTGGG - Intergenic
1074246774 10:111702187-111702209 GAAAACACCCAGGTAGACCTGGG + Intergenic
1076567132 10:131406599-131406621 GAAGATACAGAGAAAGAGCTTGG - Intergenic
1078236804 11:9492406-9492428 AAAAATACAAAATTAGGGCTGGG - Intronic
1078975385 11:16468842-16468864 AAAAATACACAGCCTGAGCTAGG - Intronic
1079467051 11:20740919-20740941 GAAAATAAAACATTAGAGCTGGG - Intronic
1079713013 11:23709588-23709610 GAAAATACACAGTCAGGGCTGGG + Intergenic
1080401081 11:31936053-31936075 AAAAATACACACTGTGAGCTTGG - Intronic
1080870573 11:36233311-36233333 TAAAATACTCAGCTAGAGCAGGG + Intergenic
1083976707 11:66127936-66127958 ATAAATACACAGTAAGATCTAGG - Intronic
1086291950 11:85321594-85321616 GAAAATAAACAGGAAGATCTAGG + Intronic
1087954980 11:104274830-104274852 GAAAATACACAGGTTGTGGTTGG - Intergenic
1088284472 11:108172234-108172256 GCAAATACACTGTTTGACCTTGG + Exonic
1090823768 11:130368849-130368871 GAAAAAATACAGTAAGAGCTAGG - Intergenic
1090932074 11:131306822-131306844 GAAAACAAACTGTTAGAGGTAGG + Intergenic
1092231005 12:6775238-6775260 GAAAACCCAAAGTTAAAGCTGGG - Intronic
1092321502 12:7481307-7481329 GAAAAAACACACTTACAGCAAGG - Intronic
1093377026 12:18441926-18441948 AAAAATACACAGATAGACGTAGG - Intronic
1093667287 12:21829790-21829812 CAAACAACACAGTTAGAGTTGGG + Intronic
1094571102 12:31641917-31641939 GAAACTACACTGTTAGAGTAGGG - Intergenic
1096505889 12:52092884-52092906 GAAAAAACACATTTTGGGCTGGG + Intergenic
1098206468 12:68115617-68115639 GAAAAGCCACAGTTAGAACAGGG + Intergenic
1098384589 12:69905420-69905442 GAAATTTCACATTTAGAGCCTGG - Intronic
1102925082 12:116820375-116820397 TAAAATACACAGGGATAGCTGGG - Intronic
1103094947 12:118125361-118125383 AAAAATACAAAATTACAGCTGGG - Intronic
1103381716 12:120499067-120499089 GAAAAGACCCAATTAAAGCTGGG + Intergenic
1104437321 12:128766401-128766423 AAAAACACACAGAAAGAGCTGGG + Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1105938297 13:25122002-25122024 GAAAATACACAGTCAGAGGAGGG + Intergenic
1106523873 13:30522686-30522708 GAAAAGGCTCAGTTATAGCTTGG + Intronic
1106957529 13:34957222-34957244 GAAAATACAGGGTTAGGGCTAGG - Intronic
1109441055 13:62375162-62375184 TAAAATACACAGTTAGTACATGG + Intergenic
1109556704 13:63985635-63985657 TAAAATACATAGGTATAGCTAGG - Intergenic
1110094359 13:71497626-71497648 GAAACTACAGACTTAGAGCAGGG - Intronic
1110649838 13:77930947-77930969 GATAATACACATTTAGAGTTTGG - Intergenic
1110694697 13:78474385-78474407 GAAAACACATAATTTGAGCTTGG - Intergenic
1114217703 14:20669258-20669280 GAGCACACAAAGTTAGAGCTGGG + Intergenic
1115620162 14:35133212-35133234 GAAAATACACAGTTAGGGCTGGG - Intronic
1116943746 14:50816429-50816451 GATAGTATACAGTTAGAGCACGG - Intronic
1117399492 14:55345704-55345726 GATAATAAACAGGTAGGGCTGGG + Intronic
1117567103 14:57004798-57004820 GAGAATACAAAGTTACATCTAGG - Intergenic
1117638006 14:57767119-57767141 AAAAATCCACAGTTAGAGTTGGG + Intronic
1118757230 14:68853871-68853893 GGAAACCCACAGCTAGAGCTGGG - Intergenic
1119295244 14:73527680-73527702 GAAAATACACAGTCAGGGCCAGG + Intronic
1120453650 14:84703362-84703384 TAAAGTCCACAGTTAGAACTTGG - Intergenic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1122763085 14:104044210-104044232 GAAAACACACAGTCAGACCCTGG - Intronic
1123179134 14:106451536-106451558 AATAATACAAAATTAGAGCTAGG - Intergenic
1125090890 15:35791433-35791455 GAAACAACATAGATAGAGCTGGG + Intergenic
1125781254 15:42270433-42270455 CAAAATACGCAGTTAGGGCTGGG + Intronic
1127024961 15:54794344-54794366 TAAACTACACATTTAGATCTAGG - Intergenic
1128000703 15:64188752-64188774 AAAAACACACAGTCAAAGCTGGG + Intronic
1128439869 15:67696279-67696301 AAAAATAGGCAGTAAGAGCTTGG - Intronic
1128714481 15:69897540-69897562 GAAAAGACCCAGCTAGAGATAGG + Intergenic
1129057092 15:72827930-72827952 TAAAATACACAGATAGACTTTGG + Intergenic
1131164358 15:90131541-90131563 GAAAATACACTCTTAGAGGCGGG + Intergenic
1131615761 15:94015662-94015684 AGAAATACATAGTTAGATCTTGG + Intergenic
1133082889 16:3337462-3337484 TAAAATACACAGTCAGGGATGGG - Intergenic
1133878887 16:9762328-9762350 GAAGATCCACACTTAGATCTCGG + Exonic
1135557598 16:23450092-23450114 AAAAATACAAAATTAGAGGTGGG - Intronic
1135567295 16:23521085-23521107 AAAAATACTAAATTAGAGCTGGG - Intronic
1136082829 16:27863888-27863910 TAAAAAACCCAGTTTGAGCTAGG - Intronic
1137012265 16:35334236-35334258 GAAAATATACAGATATACCTTGG - Intergenic
1137016629 16:35383017-35383039 GAAAATATACAGATATACCTTGG - Intergenic
1137019013 16:35404678-35404700 GAAAATATACAGATATATCTTGG - Intergenic
1138275201 16:55729245-55729267 TCATATACACAGTTAGACCTGGG + Intergenic
1138288096 16:55825132-55825154 CCATATACACAGTTAGACCTGGG - Intronic
1140127650 16:72131514-72131536 GCAGCTACAAAGTTAGAGCTGGG + Intronic
1143264775 17:5628208-5628230 AAGAATACACAGTTAGGGGTGGG - Intergenic
1143583547 17:7839877-7839899 GAAAAAAGTCAGTTAGAGGTGGG - Intergenic
1144526127 17:15991748-15991770 GAAAAAACACTGGTAGAGCTTGG + Intronic
1146535574 17:33647775-33647797 GAAAATGCCCAATTAGAGCAGGG + Intronic
1147977588 17:44256642-44256664 GTACATGCACAGTGAGAGCTGGG - Intronic
1152541307 17:80977763-80977785 AAAAATACTCAGTAAGGGCTGGG - Intergenic
1153438893 18:5095384-5095406 CAAAATATACCCTTAGAGCTTGG - Intergenic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1157237097 18:45975234-45975256 AAAAATACAAAATTAGGGCTGGG - Intergenic
1160616649 18:80135732-80135754 GCAAATACACAGTTTGGGCAAGG - Exonic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1162154946 19:8671315-8671337 AAGAAAACACAGTAAGAGCTGGG - Intergenic
1162415231 19:10532072-10532094 GAAAATACAAAATTAGGGCCCGG - Intergenic
1163075131 19:14883618-14883640 GAAAATACAAACTTAAAGCAGGG - Intergenic
1163223839 19:15940766-15940788 AAAGACACACAGTGAGAGCTGGG + Intergenic
1163307202 19:16488106-16488128 AAAAATACAAAATTAGAGCCGGG - Intronic
1163856193 19:19704191-19704213 TAAAATACACAGCCACAGCTAGG + Intergenic
1164853397 19:31502637-31502659 GAAAAGACACCGTTAGTGCCTGG + Intergenic
1165962269 19:39545002-39545024 GAAAATACAAAGGTAGTGCTTGG + Intergenic
1167664170 19:50813708-50813730 AAAAATACAAAATTATAGCTAGG - Intergenic
1168601025 19:57718744-57718766 AAAAATACAAAATTAGGGCTGGG + Intronic
925220540 2:2136140-2136162 GAACATAAAAAGTGAGAGCTAGG - Intronic
927283394 2:21331515-21331537 GAAAATACACAGATAAAGTCTGG - Intergenic
930135231 2:47896487-47896509 GAAAATACAAAGTTAGCTGTGGG - Intronic
931131364 2:59339989-59340011 GAAAACATACAGCTAGAACTGGG + Intergenic
932231753 2:70088856-70088878 GAAATTACACAGTTGGATCATGG - Exonic
933227411 2:79767047-79767069 GAAAATACACAGTCAGGGCCAGG - Intronic
933664764 2:84956009-84956031 AAAAATACAAAATTAGGGCTGGG + Intergenic
935144369 2:100384973-100384995 GAAAATACACATTTAGAAATTGG + Intergenic
935332979 2:101990798-101990820 AAAAATACAATGTTAGAGCTAGG - Intergenic
937069592 2:119053137-119053159 GATCATAGACACTTAGAGCTGGG + Intergenic
937561808 2:123233483-123233505 GAGTATACACAGTTATAACTGGG - Intergenic
937757121 2:125553475-125553497 GAATATACACAGTTTGAAGTGGG + Intergenic
939104171 2:137929831-137929853 GCCAATACACTGTTTGAGCTTGG - Intergenic
939881024 2:147631587-147631609 GAAACTTCACAGCTAGAGCCTGG + Intergenic
942967400 2:181913360-181913382 TAAAAAACACAGTTAGGGCTGGG - Intronic
944413046 2:199460186-199460208 GAAAATGCACAGTTCGAAGTCGG + Intronic
945811401 2:214554214-214554236 GCAAATACAAAGTTAGAAATAGG - Intronic
947611422 2:231527127-231527149 GGAACTACACAGTGAGATCTGGG - Intronic
948008910 2:234635040-234635062 GGAAATACAGAGTTACAGTTTGG + Intergenic
1170559955 20:17548726-17548748 AAAAATACACAGTTGGAGACTGG - Intronic
1170614255 20:17936358-17936380 GAAAATACAACGTTGGAGTTGGG + Intergenic
1171883906 20:30637708-30637730 AAAGATGCACAGGTAGAGCTTGG - Intergenic
1173555560 20:43963138-43963160 GAAAGAGCACAGTTAGAGCGAGG + Intronic
1174623642 20:51896363-51896385 GAAAGTAAAAAATTAGAGCTGGG - Intergenic
1175512616 20:59542560-59542582 GAAAATACACAGTCAGGGCTGGG - Intergenic
1177107732 21:16980643-16980665 GAAAATGCAGAGTCAGACCTTGG - Intergenic
1177424955 21:20910549-20910571 TAAAAAACAAAGTTAGGGCTGGG - Intergenic
1177429836 21:20977675-20977697 GAGAATACAAAATTATAGCTAGG - Intergenic
1177532306 21:22375823-22375845 GAAAATACACTGCAAGAGATGGG + Intergenic
1177640775 21:23841967-23841989 GATAATACACAGTCAGTGCTGGG - Intergenic
1179001344 21:37462409-37462431 GAAAATCCACATTTAGGGCTAGG - Intronic
1181395367 22:22617657-22617679 GAAAATACACAGGTAGAAGATGG + Intergenic
1182131742 22:27858300-27858322 GTAAATACAGAGTTAGAATTAGG - Intronic
1182625060 22:31639521-31639543 GAAAATATACACTTTCAGCTAGG - Intronic
1182636877 22:31735099-31735121 GAATATACACTGGTGGAGCTGGG + Intronic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1183766615 22:39882707-39882729 GAAAATACACAAAGAGGGCTGGG + Intronic
1184508303 22:44917329-44917351 GAAAATGCACAGGAAGTGCTGGG + Intronic
1184969381 22:48004304-48004326 GAAAATACACACGGAGAGCCTGG - Intergenic
1185244705 22:49766974-49766996 GAAAAGACACAGTCAGGGCCGGG - Intergenic
949588188 3:5464387-5464409 AAAGATACAAAGTTATAGCTTGG - Intergenic
950891872 3:16411237-16411259 GCAAATACACAGTTAGAAACTGG - Intronic
951579354 3:24145583-24145605 GAAAATACTCAGCCAGAGGTGGG + Intronic
952337292 3:32414969-32414991 GACAATACAGATTAAGAGCTTGG - Intronic
953736564 3:45498995-45499017 TAAAATAAACATTTACAGCTGGG + Intronic
959356212 3:105332426-105332448 GAAAATATAGAGAAAGAGCTTGG + Intergenic
960628010 3:119700529-119700551 GAAAGTACACAGACAGACCTAGG + Intergenic
960833345 3:121875593-121875615 CAAAATTAACAGTTAGAGCAGGG + Intronic
961778904 3:129309947-129309969 GAAAACAATCAGTAAGAGCTGGG + Intergenic
961939464 3:130622560-130622582 GAAAATACAGACTTTGAGCCGGG + Intronic
962113372 3:132474067-132474089 GAAAATGCTCAGTCATAGCTTGG + Intronic
963154295 3:142079091-142079113 GAAAATACACAGTCCCAGCCTGG + Intronic
963164465 3:142186924-142186946 GAAAATACACATTTTGGGCCAGG - Intronic
965797406 3:172455145-172455167 GAAAATACACATTTATAGCAGGG + Intergenic
966543345 3:181116594-181116616 GACAATATTCAGTCAGAGCTTGG + Intergenic
967468918 3:189840515-189840537 GAGAATACACAGTAAGGACTTGG + Intronic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
970327685 4:14944477-14944499 GAAAATACAGAGACAGAGATTGG + Intergenic
970671619 4:18403299-18403321 GAAATTACACAGTTTTAGCAAGG - Intergenic
970937231 4:21587502-21587524 GTAAATGAAGAGTTAGAGCTTGG + Intronic
971614924 4:28776580-28776602 GAAAATACAGAATTAAAACTAGG + Intergenic
972037113 4:34539027-34539049 GACAATACAGGGATAGAGCTAGG - Intergenic
972643375 4:40945474-40945496 GAAAATTAAGAGTTATAGCTGGG - Intronic
974242827 4:59273922-59273944 GAAAAAACACAGTAAGAAATGGG + Intergenic
974465138 4:62245953-62245975 GAAAATACACAGTTAAAAAAGGG + Intergenic
975421757 4:74172832-74172854 GAAAATACACCATTATAGCATGG - Intronic
976789040 4:88856546-88856568 AAAAGAACACAGTTAGAGTTTGG - Intronic
979139729 4:117156181-117156203 GAAAATACATAGTTAAGGATTGG - Intergenic
979781986 4:124663383-124663405 GGAAATACACTGTGAGAACTTGG - Intergenic
980453522 4:133008237-133008259 GAAAATACACAGGAAGAGGCAGG + Intergenic
980722579 4:136717219-136717241 GAATATAAACAGTGATAGCTGGG - Intergenic
981434452 4:144703640-144703662 GAACACACACAGTCAGAGCTGGG + Intronic
981770204 4:148299915-148299937 GAATATAAACAGTGATAGCTGGG - Intronic
981990997 4:150920975-150920997 GAAAATGCCCAGTCACAGCTTGG - Intronic
984194774 4:176646003-176646025 GAGAATATATAGTAAGAGCTAGG + Intergenic
986523223 5:8643659-8643681 AAAAATTCACAGTGAGGGCTGGG + Intergenic
987244921 5:16039134-16039156 GAAAATGCACAATTAGAGTGGGG - Intergenic
987378012 5:17255449-17255471 GAAAATACAGAATAAAAGCTTGG - Intronic
988041118 5:25889902-25889924 GAAAATACATACTTATACCTTGG - Intergenic
988233278 5:28506998-28507020 GAAAATACCCAGTTCGTGATAGG + Intergenic
990058960 5:51622709-51622731 CAAAATACAGAATTAGAGTTGGG + Intergenic
990319301 5:54613852-54613874 GAAAATACAAAATTAGGGCATGG - Intergenic
990785650 5:59415997-59416019 GAAAATAGAGATTTAGAGTTAGG - Intronic
992202534 5:74398553-74398575 GACAACACACAGTTAGAACCTGG - Intergenic
992476694 5:77109579-77109601 GAAAATTCCCAGGTAGAGATGGG - Intergenic
993148149 5:84123041-84123063 GAAAATACACAGTGAGAGAGAGG - Intronic
993368364 5:87060343-87060365 GAAAATAGACAGTTTGGGCCAGG - Intergenic
993764993 5:91844997-91845019 GAAAATACAAAATTAGGGCCGGG - Intergenic
993936852 5:94014833-94014855 GAAAATACACAGTCACAGGAGGG + Intronic
995726455 5:115185991-115186013 GAAAACACACTGTTAAGGCTGGG - Intergenic
996645272 5:125807243-125807265 GAAAAAACACATTTACACCTTGG - Intergenic
996819325 5:127608693-127608715 GAAAATACAAAATGAGACCTGGG + Intergenic
996943444 5:129037914-129037936 GAAAATGGAGAGTTAGGGCTAGG + Intergenic
997132648 5:131292601-131292623 AAAAGTACACAGTTAGGGCTGGG + Intronic
997167478 5:131676442-131676464 TAAAGTACACAGTTTGGGCTAGG - Intronic
999969827 5:156848275-156848297 GAAAATACAGAGTTAGGGCCAGG + Intergenic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1001258641 5:170205769-170205791 GGAAAAACCCAGTTAGAGCAAGG - Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1003105601 6:3212820-3212842 GAAACTTCACAGAGAGAGCTTGG + Intergenic
1003329851 6:5120939-5120961 GAAATTCCACAGGTAGGGCTGGG - Intronic
1003952143 6:11126341-11126363 GAAAATACGCAGCCAGGGCTGGG - Intronic
1004586290 6:17004447-17004469 GAAAATACACTGTTACAAGTTGG + Intergenic
1004676398 6:17846922-17846944 CAAAATCCACACTTAGAACTTGG + Intronic
1004862120 6:19815158-19815180 GAAAATACACAAATAGAGATTGG + Intergenic
1005205030 6:23393135-23393157 GAACATACACACTTAGAGAATGG + Intergenic
1005435157 6:25801954-25801976 GAACATCCACAGGTAGAGCTTGG + Intronic
1006012712 6:31055951-31055973 GAAAAGACAGAGTCAAAGCTGGG + Intergenic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1009247675 6:61259715-61259737 AAAAATCCACAGTTAGAGTTGGG + Intergenic
1010541338 6:77095438-77095460 GAATATAAACAGTGATAGCTGGG - Intergenic
1011003512 6:82618259-82618281 GAGAATAAACAGCTAGACCTGGG + Intergenic
1011413688 6:87093698-87093720 GAAAACTCAAAGTAAGAGCTGGG - Intronic
1012505347 6:99940285-99940307 GAAAATACACAGTCAGAAAAAGG - Intronic
1013455671 6:110327168-110327190 GAAAATACAAAGGCAGAGCATGG + Intronic
1013629934 6:111976556-111976578 AAATATACACAGTTAGAGAGAGG - Intergenic
1015079369 6:129205092-129205114 AAAAATCCAAAGTTATAGCTGGG + Intronic
1015194591 6:130511086-130511108 GAAATTACACAGTCTCAGCTGGG + Intergenic
1015702345 6:136050338-136050360 GAAAATTCACAGAGAGGGCTTGG - Intronic
1015762475 6:136679640-136679662 GGAAAAACACAGTTAGAACTTGG - Intronic
1015973135 6:138762752-138762774 AAAATTACACAGCTAGAACTAGG + Intronic
1016152671 6:140762173-140762195 GAAAATTCAAAGTTTGAACTGGG + Intergenic
1016263874 6:142208376-142208398 GAAAATACACAGTCAGAAGAAGG + Intronic
1016266682 6:142240636-142240658 TAAAATACATAATTAGAGGTTGG - Intergenic
1016700000 6:147043617-147043639 GAAAATAAACAATTAGAACAGGG - Intergenic
1018618793 6:165711196-165711218 CTAAATACACCGTTAGAGTTGGG + Intronic
1020847550 7:13306423-13306445 GAAAATACAAAAATATAGCTGGG + Intergenic
1021842499 7:24732280-24732302 GAAAAAACAAAGTTTGAACTGGG - Intronic
1022157578 7:27675712-27675734 GAAAAGTCACAGTTGGGGCTGGG - Intergenic
1022513736 7:30962150-30962172 GAACATGTACAGTTAGAGCAGGG + Intronic
1023087464 7:36585763-36585785 GAAAATACACAGAAAGGGCCTGG + Intronic
1023894054 7:44417467-44417489 GAAAATAACCAGTTTTAGCTTGG + Intronic
1024140798 7:46461366-46461388 GCAAAAAAACAGTTAGGGCTGGG + Intergenic
1026428419 7:70319633-70319655 GAAAATACACCCTTTGAGGTTGG - Intronic
1027544351 7:79507687-79507709 GGAAATGCACAGTTACACCTTGG + Intergenic
1027579039 7:79969677-79969699 GAAGATTCACTGTTAGGGCTGGG - Intergenic
1027953969 7:84856428-84856450 CAAAATACACAGGGAGAGATTGG + Intergenic
1027982224 7:85239883-85239905 GAAAATAAATAGTTACAGGTTGG - Intergenic
1028547618 7:92021245-92021267 GAAAATAAACAATTAGAGAACGG - Intronic
1028704036 7:93816974-93816996 TAAAATACACAGATAGGTCTGGG + Intronic
1029265042 7:99332057-99332079 GGAAATAAACAGTTAAAGCCAGG - Intronic
1031910030 7:127506214-127506236 CTAAATACACAGCTAGAGCAAGG - Intergenic
1031955926 7:127942315-127942337 TAAAATACCAAGTTAGAGGTGGG + Intronic
1032527433 7:132589955-132589977 GAAAATACTCAGTTCCAGGTGGG + Intronic
1034069055 7:148164941-148164963 GAAAGTACAGAGTTAGAGCCAGG - Intronic
1034515185 7:151571366-151571388 AAAAATACAAAATTAGAGCCAGG - Intronic
1035445281 7:158937329-158937351 GAAAATACACAATCAATGCTGGG + Intronic
1037253727 8:16927138-16927160 GAAAATAAGAAGTTAAAGCTTGG - Intergenic
1037931341 8:22882153-22882175 GAAAATAAGCATTTAGAACTGGG + Intronic
1038361170 8:26878894-26878916 GAAAATACAAAGTAAAAACTTGG - Intergenic
1039237248 8:35515387-35515409 CAAAATACAGATTTAGGGCTGGG + Intronic
1039929351 8:41970279-41970301 GGAAATAAACAGCTAGATCTTGG - Intronic
1040511332 8:48098917-48098939 GAAAATACACAGAGAAGGCTGGG - Intergenic
1040601007 8:48883803-48883825 GAAAATACAGAGTTGGGGGTGGG + Intergenic
1042198971 8:66260738-66260760 GAAAATACACAATCAGAGCCAGG + Intergenic
1043991766 8:86764368-86764390 GAAAATTCACATATAGAGTTAGG - Intergenic
1045976173 8:108132412-108132434 CAAAATACACAATTATAGTTAGG - Intergenic
1046211621 8:111083224-111083246 TAAAAAACACAATTAGAACTGGG - Intergenic
1047479618 8:125268874-125268896 GAAAATACAAATTGAGATCTTGG + Intronic
1047885998 8:129250724-129250746 GAGAAAACACAGTGAGAGCCAGG + Intergenic
1049217952 8:141416304-141416326 GAAAAACCACATTTGGAGCTGGG - Intronic
1049398929 8:142416209-142416231 GAAAATACACTATTCGTGCTTGG + Intergenic
1050613811 9:7381131-7381153 GAAAAAACACAGTTATAGATAGG + Intergenic
1052070468 9:24075495-24075517 GATAATACATAGTGAGGGCTGGG - Intergenic
1052071323 9:24084947-24084969 GAAAATACACTGTTATAAGTTGG - Intergenic
1052188987 9:25634515-25634537 ATAAATAGACAGTGAGAGCTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053534487 9:38912472-38912494 AAAAATACAAAATTAGGGCTGGG - Intergenic
1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG + Intergenic
1054206708 9:62136891-62136913 AAAAATACAAAATTAGGGCTGGG - Intergenic
1054631644 9:67451456-67451478 AAAAATACAAAATTAGGGCTGGG + Intergenic
1055546997 9:77388013-77388035 GAAAATACGCAGTAACAGCTGGG - Intronic
1055760390 9:79600751-79600773 AAAACAACACAGTTAGAGCCAGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057325195 9:94056624-94056646 GAAAATACACATGTAGATTTTGG + Intronic
1057526067 9:95802988-95803010 GAAAATTAACAGTCAGAACTTGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057880164 9:98787137-98787159 GGAACTGCACAGTAAGAGCTGGG + Intronic
1057968620 9:99530531-99530553 GAGAAGACACAGTCTGAGCTGGG - Intergenic
1058707735 9:107651109-107651131 AAAAATACACAGTCAGCTCTGGG + Intergenic
1058852254 9:109024195-109024217 GGAAATACACACTCAGTGCTGGG - Intronic
1060956293 9:127643155-127643177 GAAAATATAAAGTTTGACCTGGG - Intronic
1061166380 9:128924964-128924986 GTAAATACACAAATACAGCTAGG - Intronic
1185594943 X:1300460-1300482 GAAAAAAGAAAGTTAGAGATAGG - Intronic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1188176111 X:26992015-26992037 GAAAATACAAAGTAAGAGTCTGG + Intergenic
1188603467 X:31998402-31998424 AAAAGTACACAGTCAGATCTGGG - Intronic
1189721900 X:43928339-43928361 GTAAAGACACAGTTTGAGCAAGG + Intergenic
1190837254 X:54112544-54112566 GAAAATACAAAATTAGGGCCGGG + Intronic
1190850611 X:54237139-54237161 GAAAATTCACTATCAGAGCTAGG + Exonic
1191189539 X:57651604-57651626 GAAAATAAACAGTGATAGTTGGG - Intergenic
1192012277 X:67287555-67287577 GAAAATTCACAATTAGAGACTGG - Intergenic
1192347150 X:70320065-70320087 GAAAAGTAACAGTTTGAGCTAGG - Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192958629 X:76102850-76102872 GAAAATACACAGTCAAGACTGGG - Intergenic
1193945412 X:87727935-87727957 GAATATACACAGTGATAGCTGGG + Intergenic
1194799734 X:98257669-98257691 CAAAATACACAAATAAAGCTGGG + Intergenic
1194855430 X:98921884-98921906 GAAAAGACATAGTAATAGCTTGG + Intergenic
1196320922 X:114339414-114339436 GAGAATACAAAGTTAGACCCGGG - Intergenic
1197268165 X:124397931-124397953 GAAAAGTCACAGTTGGGGCTGGG + Intronic
1197947277 X:131852922-131852944 AAAAATACACAGTTTGGGCCAGG + Intergenic
1200136429 X:153877146-153877168 AAAAATACAAAATTAGGGCTGGG + Intronic