ID: 968007963

View in Genome Browser
Species Human (GRCh38)
Location 3:195255846-195255868
Sequence ATTTAGCTGCAGAAGAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 417}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968007963_968007970 -10 Left 968007963 3:195255846-195255868 CCAGACCTCTTCTGCAGCTAAAT 0: 1
1: 0
2: 1
3: 23
4: 417
Right 968007970 3:195255859-195255881 GCAGCTAAATGAGGGAGGTGGGG 0: 1
1: 0
2: 2
3: 23
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968007963 Original CRISPR ATTTAGCTGCAGAAGAGGTC TGG (reversed) Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903209855 1:21811806-21811828 ATTTAGTTGGAGAGGTGGTCAGG + Intergenic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906563937 1:46783270-46783292 ATTTATCTGAAAAAGAGTTCAGG - Intronic
906912415 1:49968599-49968621 ACTTAGCTGCAGTAGAGGCTGGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907895663 1:58687797-58687819 AGGTATCGGCAGAAGAGGTCTGG - Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910623421 1:89281098-89281120 AGTGAGGTGCAGAAGAGGTTAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912531646 1:110328313-110328335 ATTTAGCTGCAAGAGAGGCTGGG - Intergenic
913509941 1:119552340-119552362 GTTTAGCTGCAGAAGTGTGCAGG - Intergenic
913517431 1:119616440-119616462 GTTTAGCTGCAGAAGTGTGCAGG - Intergenic
915152773 1:153848191-153848213 ATTTTGCTGTAGAAGGGTTCAGG - Intronic
915926379 1:160023263-160023285 ATTTAGCTCCAGAAGATCTAGGG + Intergenic
916599417 1:166277252-166277274 ATTGAGCTGCATAGGAGGCCTGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918933765 1:190893218-190893240 CTATGGCTGCAGAAGAGGTTGGG + Intergenic
919154928 1:193751812-193751834 ATTCAGCTGCAGAAGAGTAGTGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065758909 10:28963607-28963629 AGTTAGCAGGAGAAGAGGCCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070810360 10:79294615-79294637 GTTTACCTGCAGAAGACGTAGGG + Intronic
1071130748 10:82390733-82390755 ACTTCTCTGCAGAAGAGGACTGG + Intronic
1071168002 10:82829349-82829371 CTTTATCTGCAGATGAGGTCTGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072668219 10:97409953-97409975 ATTTAGCTGCAGAAGGGGCTGGG + Intronic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073774528 10:106770996-106771018 AGCTACCTGAAGAAGAGGTCTGG + Intronic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078903994 11:15667359-15667381 ATATAGCTGCAAAGGAGGCCAGG - Intergenic
1079568406 11:21912368-21912390 ACTTAGCTACAGAAGAGTACAGG - Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085334563 11:75681555-75681577 ATTTAGCTTGAGAAGAGATCGGG - Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090205285 11:124880406-124880428 CTTGTGCTGCAGAAGAGGCCTGG + Exonic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090721609 11:129480338-129480360 AACTAGCTGCAGAAGAGGCTGGG + Intergenic
1090795826 11:130134963-130134985 ATTTAGGTGAGGCAGAGGTCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094265131 12:28549675-28549697 ATCCAACTGCAGAAGAGGTTAGG - Exonic
1094362230 12:29641752-29641774 ATTTACCTGGAGAAGAATTCAGG + Intronic
1094752903 12:33434400-33434422 ATTTAGTTGCAGAAGAGATTTGG + Intronic
1095227792 12:39697335-39697357 ATTTTCTTGCAGAACAGGTCTGG - Intronic
1095368163 12:41433435-41433457 ATTTAACTGCAGAAAATGTTAGG + Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096420436 12:51452630-51452652 GTTCACCTGCAGAAGAAGTCTGG - Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097284669 12:57868302-57868324 ACTTAGCTGCAGGAGAGGTTGGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098912562 12:76224527-76224549 ATTTATCTTAAGTAGAGGTCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099477049 12:83121134-83121156 ATTTACCTGCAAAAGAATTCAGG - Intronic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100340092 12:93670498-93670520 ATTAAGATGCAGCAGAGGCCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101899771 12:108782986-108783008 ATTTTGTTGCAAAAGAGCTCAGG + Exonic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103396526 12:120611420-120611442 AGTTACCTGCAGAACATGTCAGG - Intergenic
1104504397 12:129318124-129318146 ATTTACCTGAAAAAGAGTTCAGG - Intronic
1105822942 13:24096155-24096177 GTTTAGCTCCAGAACAAGTCAGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108146806 13:47485908-47485930 ACTTAGATGCAAGAGAGGTCGGG - Intergenic
1109429095 13:62208727-62208749 CCTTTGCTGCAGAAGTGGTCTGG - Intergenic
1110025994 13:70540107-70540129 ATATAGCAGCAGAAGATTTCAGG + Intergenic
1110034641 13:70667575-70667597 ATTGAGCTACAGAAAAGGTTAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115504937 14:34084921-34084943 ATTTACCTGCAAAATAGATCAGG + Intronic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116764321 14:49051794-49051816 ATTTTGTGGCAGAAGAGGGCTGG - Intergenic
1117145621 14:52834212-52834234 AATTAGCTGAAGAACAGATCTGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117551620 14:56842910-56842932 ATCTAGCTGCAGAGGAGGTAGGG + Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1119437774 14:74609452-74609474 ATTTAGGTGCAGGTGAGGTGCGG - Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1202830769 14_GL000009v2_random:26913-26935 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1125392424 15:39208602-39208624 TTTTAGCTTCAGAACAGGTCTGG - Intergenic
1126294792 15:47127927-47127949 ATTTACTTGTAGAATAGGTCTGG + Intergenic
1126962877 15:54017829-54017851 ATTTACCTGCATATGAGGCCTGG + Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129168400 15:73792775-73792797 ATTCAGATGCAGAAGAGGACAGG - Intergenic
1130201482 15:81832400-81832422 ATTTAGAAGCAGGAGAGGTTGGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1134441936 16:14303576-14303598 ATTTAGCTGGAGATGGGGTGGGG + Intergenic
1135346888 16:21696369-21696391 ATTTGGATGCAGAAGGGGTAAGG + Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1137626900 16:49914810-49914832 AATCATCTGCAGAAGAGGTGGGG + Intergenic
1137753244 16:50881995-50882017 AGTGAGGGGCAGAAGAGGTCAGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142734432 17:1886953-1886975 AGGAAGCTGCAGAAGAGGCCAGG - Intronic
1144247508 17:13382024-13382046 ATTGAAATGTAGAAGAGGTCGGG - Intergenic
1146194306 17:30798463-30798485 ATTTAGATGGAAAAGAGTTCTGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146548651 17:33761489-33761511 ATCTTGCTGCAGATGTGGTCTGG + Intronic
1146722713 17:35134347-35134369 AGCTAGCTGCTGAAGAGGTAGGG - Intronic
1148425952 17:47596182-47596204 ACTTAGTTGCAGAAGAGGGGTGG + Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153235341 18:2980726-2980748 CTTCCGCTGGAGAAGAGGTCTGG + Intronic
1153957636 18:10111781-10111803 ATTCAGCTGCAGAGTTGGTCAGG + Intergenic
1154147438 18:11877906-11877928 ATTCAGCTGCAGAAGCTCTCTGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156481283 18:37437913-37437935 AATTAGGTGTAGATGAGGTCAGG + Intronic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156602613 18:38627308-38627330 AGATATCTGCAGAAAAGGTCAGG - Intergenic
1156664141 18:39384863-39384885 ATACATCAGCAGAAGAGGTCAGG + Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1159269520 18:66130595-66130617 TTTTAACTGAAGGAGAGGTCAGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160058204 18:75506202-75506224 ATTTAGCTGCAGCAAACATCGGG - Intergenic
1163311345 19:16516766-16516788 GTTTATCTGCTGAAGAGGGCAGG + Intronic
1163534469 19:17869259-17869281 ATTTATCTGCTGGTGAGGTCAGG + Intergenic
1168284625 19:55324737-55324759 ATTTGGCAGCAGAAGGGGTGAGG - Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1202641924 1_KI270706v1_random:100863-100885 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
925321846 2:2976414-2976436 ATTATGCTGCAGAAGAAGGCAGG + Intergenic
926541523 2:14185845-14185867 ATTTAGCTGCAAAAGAGGCCAGG - Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
928733839 2:34262395-34262417 ATTTACCTGCAAAAGAATTCAGG + Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931884289 2:66599126-66599148 ACTTAGCTGCAGGAGAGGCTGGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940314166 2:152309994-152310016 GTTTATCTGCAGAGGAGGTTAGG + Intergenic
941286024 2:163613145-163613167 AGTTAGTTACAGAAGAGGACTGG + Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942306334 2:174610910-174610932 TTTTGGCTGGAGAAGAGGGCCGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943317251 2:186405392-186405414 ATTCAGCTGCAGAGGAAGTATGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1169300943 20:4441419-4441441 ATTTAGCCTCAGAAGAGGCAAGG + Intergenic
1170669527 20:18418309-18418331 ATTTGGCTGCTGAAGAGGCAGGG + Intronic
1171889039 20:30691053-30691075 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1173169009 20:40707364-40707386 ATTTATTTGCAGAAGAGCTGGGG + Intergenic
1174262139 20:49304237-49304259 CATTAGCTGCAGAGGAGGTTGGG - Intergenic
1174341570 20:49900327-49900349 AATTTGCTTCAGAAGAGTTCAGG + Intergenic
1175157951 20:56985944-56985966 ATCTAGCTGCAAAAGAGTCCAGG - Intergenic
1176609956 21:8871751-8871773 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178704365 21:34861233-34861255 ATCTAGCTGAAGGAGAGGACTGG + Intronic
1180360021 22:11881002-11881024 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180749468 22:18114179-18114201 AATAAGCTGCAGAAGAGAGCAGG + Intronic
1181997325 22:26893052-26893074 ATTTAGCTGCAGATGTGGGCAGG - Intergenic
1182609760 22:31537345-31537367 CTTTAGCTACAGAGGAGGTTTGG + Intronic
1183184576 22:36284749-36284771 ATGTAACTGGAAAAGAGGTCTGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953574259 3:44100376-44100398 GTTTTTCTGCAGATGAGGTCGGG - Intergenic
954363312 3:50133748-50133770 AGTTACCTGCAGATGAGGACTGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956393631 3:68801093-68801115 ATTTAAATCCAGAAGAAGTCTGG - Intronic
956446453 3:69330790-69330812 ATTCAGCGGCAAAAGAGGCCGGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959588439 3:108048759-108048781 ACTTTGCTACAGAAGAGGGCAGG + Intronic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959908776 3:111739555-111739577 TTTTAACTTCAGAAGAGGTGTGG - Intronic
960663801 3:120090784-120090806 ATTGAGATTCAGAAGAGATCTGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964818748 3:160746367-160746389 ATTTGGATGCAGAAGAGGAGAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966623848 3:181995323-181995345 ATTTACCTGAAAAAGAAGTCAGG + Intergenic
968007963 3:195255846-195255868 ATTTAGCTGCAGAAGAGGTCTGG - Intronic
968176773 3:196557365-196557387 TTTTTGCTGCAGAGGAGGGCTGG - Intronic
1202736642 3_GL000221v1_random:6541-6563 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
971019387 4:22518225-22518247 ATATAGCAGCAGAAAAGGGCTGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972627272 4:40812296-40812318 ATTTAGCTGCATAAAACGTTCGG - Intronic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
974073766 4:57149834-57149856 ATTTAGCTGCTGAAGTTTTCTGG + Intergenic
974128264 4:57721404-57721426 AAATAGTTGGAGAAGAGGTCAGG - Intergenic
974471752 4:62328086-62328108 ATTTATTTACAGAAGTGGTCTGG + Intergenic
974650020 4:64743113-64743135 ATATAGGAGCAGAAGAGGTGTGG + Intergenic
974882554 4:67777858-67777880 AGTTATCTGAAAAAGAGGTCTGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975688490 4:76942623-76942645 ACTTAGCTGCAGAGGAGGCTAGG - Intergenic
976591148 4:86850983-86851005 ATTTAGCAAGAGAAGGGGTCAGG + Intergenic
977019886 4:91746184-91746206 ATTTAACTGAAAAAGAAGTCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979704948 4:123709888-123709910 ATTTACCTGAAAAAGAAGTCAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981144465 4:141308918-141308940 CTTGACCTGCAGAAGAGGTTCGG + Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982825342 4:159997320-159997342 ATTTTACTGAAGAAGAGGTGGGG - Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983591320 4:169414690-169414712 ATATATCTGGAGCAGAGGTCAGG - Intronic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984921173 4:184765824-184765846 CTTTTGGTGCAGAAGAGGACTGG + Intronic
1202769292 4_GL000008v2_random:186728-186750 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987059001 5:14224223-14224245 ATTAACCTGCAGATGAGGTAGGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989518677 5:42375167-42375189 AGTTAGCGGCAGAAGAGGGTGGG + Intergenic
990634449 5:57709087-57709109 ATCTAGCTGCACCAGAGGTGGGG - Intergenic
990689776 5:58350625-58350647 ATTTCCCTGCAGAAGAGGCTAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995817931 5:116192326-116192348 ATTTACCTGAAAAAGAGTTCAGG + Intronic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996681671 5:126234258-126234280 CTTTAGTTGCAGATGAGATCTGG - Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
996942766 5:129028982-129029004 TTTTAGGTGCAGGAGAGATCAGG + Intronic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998777375 5:145618164-145618186 ATTTACCTGAAGAAGAATTCAGG - Intronic
999530638 5:152459515-152459537 ACTTAGCTGCAAAAGAGGAATGG - Intergenic
1000005705 5:157182335-157182357 ATGGAGCTCCAGAGGAGGTCAGG + Intronic
1000908608 5:166994159-166994181 ACGTAGCTACAGAAGAGATCTGG - Intergenic
1001139629 5:169133757-169133779 ATGTAGGTGCAAAAGAGGTATGG + Intronic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006622267 6:35374082-35374104 ATTCACCAGCAGCAGAGGTCAGG - Intronic
1006870019 6:37242985-37243007 ATGTAGCTGCAGGAGAGGCTGGG + Intronic
1007184142 6:39953293-39953315 ATTTAACTGCAAAAGAGTTTGGG + Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010020943 6:71159151-71159173 ATTAAAATGCAGATGAGGTCGGG - Intergenic
1010977345 6:82330664-82330686 ATTCAACTGCAGCAGAGATCCGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012386219 6:98686225-98686247 CTTCAGGGGCAGAAGAGGTCTGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013720938 6:113027698-113027720 ATTTACCTGAAAAAGAAGTCAGG - Intergenic
1013761783 6:113527097-113527119 AATTAGTGGGAGAAGAGGTCTGG + Intergenic
1014487895 6:122023112-122023134 ATTTAGCTTCAGAAAAGTTTTGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015655016 6:135508143-135508165 ATTAAGATGCAGAAGAGGGCGGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016630017 6:146218130-146218152 ATTTAGGTGGATAAGAGATCAGG - Intronic
1017295285 6:152786420-152786442 ATTTAGCTGTTTAAAAGGTCAGG + Intergenic
1017625578 6:156344647-156344669 AGTTAGCTGCATTTGAGGTCTGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1018844322 6:167545213-167545235 ATTTAGCTGCAGGCCAGGTGCGG + Intergenic
1019227885 6:170530104-170530126 TTCTCACTGCAGAAGAGGTCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024922388 7:54573013-54573035 GTTAAGCACCAGAAGAGGTCAGG - Intergenic
1026139090 7:67689642-67689664 ATTTACCTGAAGAAGAATTCAGG - Intergenic
1026583378 7:71636248-71636270 ATCTTGCTGCAGAAGAGATGTGG + Intronic
1027856984 7:83524286-83524308 ATTTATCTGCTGAAGAAGACTGG - Intronic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030220211 7:107090482-107090504 AATTAGCTCCAGGTGAGGTCAGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1035116619 7:156529963-156529985 AATTAGTTGCAGCAGAGCTCAGG - Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038239466 8:25795372-25795394 ATTTACATGCAGAAGTGGGCAGG + Intergenic
1039712967 8:40075888-40075910 ATTTGGCTGTAGAATAGGTTGGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042294504 8:67204674-67204696 ACTTAGCTGCAGCACAGGTAAGG - Exonic
1042304033 8:67313265-67313287 ATTTACCTGAAAAAGAGTTCAGG - Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045405048 8:101857598-101857620 ATTTGCATGCAGAAGAGGACAGG + Intronic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046528359 8:115411078-115411100 ATTTTGGTGGAGAAGAGGTTGGG - Exonic
1047768318 8:128008512-128008534 AATTAGCTGCAAAAGAAGTAGGG - Intergenic
1050352099 9:4749993-4750015 ATTTAGCTGCTGAATAGTTATGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051067448 9:13121772-13121794 ATTGAGCTGCAGAAGAAGCCGGG - Exonic
1051362788 9:16295573-16295595 ATTTACCTGAAAAAGAGTTCAGG + Intergenic
1051718176 9:20007783-20007805 CTTGTGCTGCAGAAGAGGACAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1054360421 9:64108911-64108933 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056502905 9:87228063-87228085 ATATAGCTGGAGAGGAGGTAGGG - Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059203740 9:112444138-112444160 ATATATCTACAGAAAAGGTCAGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1203694180 Un_GL000214v1:80444-80466 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203705374 Un_KI270742v1:36981-37003 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1203558635 Un_KI270744v1:28824-28846 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203642093 Un_KI270751v1:23619-23641 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189969718 X:46405828-46405850 GATTTGCTGGAGAAGAGGTCAGG + Intergenic
1190895362 X:54613416-54613438 ATTTATCTGAAAAAGAGTTCAGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193305421 X:79944841-79944863 ATTTACCAGCAAAAGAGGTATGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194565590 X:95484161-95484183 CATTATCTGAAGAAGAGGTCAGG + Intergenic
1194791451 X:98155984-98156006 AATGAGCTGGAGAAGAGTTCTGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1200780001 Y:7206110-7206132 AGGAACCTGCAGAAGAGGTCAGG - Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic