ID: 968008730

View in Genome Browser
Species Human (GRCh38)
Location 3:195259780-195259802
Sequence GAGGGGCCACCCCCACCACG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 291}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968008727_968008730 -7 Left 968008727 3:195259764-195259786 CCGGCGCCAGGATACCGAGGGGC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 968008730 3:195259780-195259802 GAGGGGCCACCCCCACCACGCGG 0: 1
1: 0
2: 0
3: 23
4: 291
968008717_968008730 19 Left 968008717 3:195259738-195259760 CCTCGGGTCTTTTGCCAAATTCC 0: 1
1: 0
2: 0
3: 4
4: 89
Right 968008730 3:195259780-195259802 GAGGGGCCACCCCCACCACGCGG 0: 1
1: 0
2: 0
3: 23
4: 291
968008716_968008730 29 Left 968008716 3:195259728-195259750 CCTCTGGCGGCCTCGGGTCTTTT 0: 1
1: 0
2: 0
3: 11
4: 131
Right 968008730 3:195259780-195259802 GAGGGGCCACCCCCACCACGCGG 0: 1
1: 0
2: 0
3: 23
4: 291
968008719_968008730 5 Left 968008719 3:195259752-195259774 CCAAATTCCCCACCGGCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 968008730 3:195259780-195259802 GAGGGGCCACCCCCACCACGCGG 0: 1
1: 0
2: 0
3: 23
4: 291
968008722_968008730 -3 Left 968008722 3:195259760-195259782 CCCACCGGCGCCAGGATACCGAG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 968008730 3:195259780-195259802 GAGGGGCCACCCCCACCACGCGG 0: 1
1: 0
2: 0
3: 23
4: 291
968008721_968008730 -2 Left 968008721 3:195259759-195259781 CCCCACCGGCGCCAGGATACCGA 0: 1
1: 0
2: 0
3: 1
4: 36
Right 968008730 3:195259780-195259802 GAGGGGCCACCCCCACCACGCGG 0: 1
1: 0
2: 0
3: 23
4: 291
968008723_968008730 -4 Left 968008723 3:195259761-195259783 CCACCGGCGCCAGGATACCGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 968008730 3:195259780-195259802 GAGGGGCCACCCCCACCACGCGG 0: 1
1: 0
2: 0
3: 23
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968008730 Original CRISPR GAGGGGCCACCCCCACCACG CGG Intronic