ID: 968010505

View in Genome Browser
Species Human (GRCh38)
Location 3:195271130-195271152
Sequence CACTTAGCCCCGGCGCCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968010491_968010505 20 Left 968010491 3:195271087-195271109 CCAGCAACGCGGGAGAGCCCTCG 0: 1
1: 0
2: 0
3: 5
4: 35
Right 968010505 3:195271130-195271152 CACTTAGCCCCGGCGCCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 71
968010497_968010505 2 Left 968010497 3:195271105-195271127 CCTCGGGTACCCGGACGCCGGCG 0: 1
1: 0
2: 1
3: 9
4: 67
Right 968010505 3:195271130-195271152 CACTTAGCCCCGGCGCCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 71
968010499_968010505 -7 Left 968010499 3:195271114-195271136 CCCGGACGCCGGCGGCCACTTAG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 968010505 3:195271130-195271152 CACTTAGCCCCGGCGCCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 71
968010496_968010505 3 Left 968010496 3:195271104-195271126 CCCTCGGGTACCCGGACGCCGGC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 968010505 3:195271130-195271152 CACTTAGCCCCGGCGCCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 71
968010490_968010505 29 Left 968010490 3:195271078-195271100 CCAGCGGTGCCAGCAACGCGGGA 0: 1
1: 0
2: 3
3: 157
4: 6536
Right 968010505 3:195271130-195271152 CACTTAGCCCCGGCGCCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 71
968010500_968010505 -8 Left 968010500 3:195271115-195271137 CCGGACGCCGGCGGCCACTTAGC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 968010505 3:195271130-195271152 CACTTAGCCCCGGCGCCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968010505 Original CRISPR CACTTAGCCCCGGCGCCAGG CGG Exonic
900001555 1:17497-17519 CACATAGGCCAGGAGCCAGGGGG - Intergenic
900021275 1:188021-188043 CACATAGGCCAGGAGCCAGGGGG - Intergenic
900077493 1:829248-829270 CATTAAGCCCGGGCGCCGGGTGG - Intergenic
900658646 1:3772410-3772432 CGCCCAGCCCCGGGGCCAGGAGG - Intergenic
900932695 1:5747044-5747066 TACTCAGCCCCAGCACCAGGTGG - Intergenic
902944150 1:19822154-19822176 CACTTGGCCCAGGCTCCAGTGGG + Intergenic
904623555 1:31789541-31789563 CCCTTCGCCCCGGGGCCAGAAGG - Intergenic
914334320 1:146701026-146701048 CATTTAGCCCTGGGGCCAGAGGG + Intergenic
914947768 1:152081141-152081163 CACCTGGGCCGGGCGCCAGGCGG - Intergenic
919101757 1:193105160-193105182 CCCTTTGCCCCGGCGCCGGGTGG - Intronic
920192382 1:204201868-204201890 GACTTAGGCCTGGAGCCAGGCGG + Intronic
1066026607 10:31364382-31364404 CACCTGGGCCAGGCGCCAGGTGG - Intronic
1069386031 10:67884464-67884486 CACTCGGCCCCGGCGGCCGGCGG - Intergenic
1071544797 10:86521358-86521380 CACTTACCCTCGGAGCCTGGCGG + Exonic
1076001929 10:126919456-126919478 CACTTGGCCACGGTGCCTGGAGG - Intronic
1077066591 11:643785-643807 CTCATGGCCCTGGCGCCAGGTGG - Intergenic
1083263938 11:61537570-61537592 CCCTGAGCCCGGGCACCAGGAGG - Intronic
1083665110 11:64269933-64269955 GACTTAGCGCAGGCGCCTGGGGG + Exonic
1084384981 11:68837954-68837976 CACTTAGCCCCGGCTGCATGTGG + Intronic
1084973983 11:72786471-72786493 CACTTAGATCCGGCTCCAGGTGG - Intronic
1091374642 12:17614-17636 CACATAGCCCAGGAGCCAGGGGG - Intergenic
1094414549 12:30202792-30202814 CACTTAGCCACAATGCCAGGAGG - Intergenic
1097235141 12:57534289-57534311 CACTTAGCCAGGGCGCCATCGGG + Exonic
1101914295 12:108884431-108884453 CACTTAGTGCCGGGGCCAGCTGG + Intronic
1105000525 12:132687446-132687468 CAATTGGCGCCGGCGCCCGGCGG + Intergenic
1113884587 13:113651956-113651978 CACTTGGCCCAGGCTTCAGGAGG + Intronic
1123110548 14:105865025-105865047 CACTTAGCCCTGGGGCCAGCTGG - Intergenic
1126798906 15:52282620-52282642 CAGTGAGTCCCGGCACCAGGAGG + Intronic
1127665478 15:61141947-61141969 CACTTAGCCCAGGAGCCACCTGG - Intronic
1132451954 15:101973439-101973461 CACATAGGCCAGGAGCCAGGGGG + Intergenic
1132454942 16:17182-17204 CACATAGCCCAGGAGCCAGGGGG - Intronic
1134644758 16:15857262-15857284 GTCTCAGCCCCGGCCCCAGGCGG + Intergenic
1138829627 16:60360034-60360056 CACCTGGGCCAGGCGCCAGGCGG - Intergenic
1139999297 16:71010206-71010228 CATTTAGCCCTGGGGCCAGAGGG - Intronic
1142384202 16:89752287-89752309 CACTCAGCTCCGGAGGCAGGAGG - Intronic
1143253214 17:5537718-5537740 AACTAAGTCCCGGCTCCAGGAGG + Intronic
1151964082 17:77422332-77422354 CACCCAGCCTCGGGGCCAGGCGG + Intronic
1158139634 18:54242444-54242466 CACTTGTCCCCGGCTCCAGCAGG + Intergenic
1160101355 18:75922901-75922923 CACTGAGCCCGGGTGGCAGGTGG + Intergenic
1163770079 19:19185868-19185890 CACTTGGCCAGGGCCCCAGGTGG - Intronic
1166852644 19:45767880-45767902 CACTTAGTCCCCGCGCCCCGCGG + Intronic
1167794806 19:51702450-51702472 GGCTTGGCCCCGGCCCCAGGTGG + Intergenic
1168145474 19:54418134-54418156 CACTGAGCCCCGGAGCATGGAGG - Intronic
1168153784 19:54462416-54462438 CATTTAGCCCCGGGGCCAAGAGG + Exonic
928262367 2:29779306-29779328 CACTCAGCCCAGGCCCCAGGTGG - Intronic
930011402 2:46940988-46941010 CGCGGAGCCCCGGCGCCCGGGGG - Intronic
934761625 2:96859952-96859974 CACTGAACCCCGGGGCCAAGTGG + Exonic
937991440 2:127664425-127664447 CCCATAGCCCCTGCACCAGGCGG - Exonic
938249398 2:129802505-129802527 CACTTAGCCTCAGCAGCAGGTGG - Intergenic
945088872 2:206160100-206160122 CACGTGGCCCCGGCCCCGGGCGG - Intronic
948987674 2:241535138-241535160 CCATTAGCCCGGGCACCAGGAGG + Intergenic
1173733751 20:45345668-45345690 GACTTGGCCCCGGGCCCAGGCGG - Intronic
1180119478 21:45737194-45737216 CTCTCAGCCCCGACGCCACGTGG - Intronic
1180179099 21:46110015-46110037 CACTTATCCCCGGCTCCTGCTGG + Intronic
1184060830 22:42079963-42079985 CCCTTCGCCCCGTCTCCAGGAGG - Intronic
1184473425 22:44708348-44708370 CACCTAGCCCTGGCCCCAGCTGG - Intronic
1185282961 22:49983530-49983552 CCCTTATTCCCGCCGCCAGGGGG + Intergenic
968010505 3:195271130-195271152 CACTTAGCCCCGGCGCCAGGCGG + Exonic
978112101 4:104976028-104976050 CACATAGCCCTGGGGCCTGGAGG - Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
985733477 5:1564356-1564378 CAGTCAGCCCCGGCAGCAGGCGG - Intergenic
1005243017 6:23853857-23853879 CACCTGGGCCAGGCGCCAGGTGG + Intergenic
1006024463 6:31138362-31138384 CACCCAGCCCCAGCCCCAGGAGG + Intronic
1022311399 7:29199949-29199971 CACTCAGGCCAGGCCCCAGGTGG - Intronic
1029468069 7:100738523-100738545 CACTTGGCCCCGGAGGCAGTTGG - Exonic
1034431027 7:151041192-151041214 AACCTGGCCCCGGAGCCAGGAGG - Exonic
1035515684 8:230638-230660 CATTAAGCCCGGGCGCCGGGTGG + Intergenic
1035752838 8:2008196-2008218 CACTCAGCCCCAACCCCAGGGGG + Intergenic
1035753139 8:2009644-2009666 CACTCAGCCCCAACCCCAGGGGG + Intergenic
1035753164 8:2009733-2009755 CACTCAGCCCCAACCCCAGGGGG + Intergenic
1049884363 9:17610-17632 CACATAGGCCAGGAGCCAGGGGG - Intergenic
1051774739 9:20621683-20621705 AACTTTGCCCCAGCGCCGGGAGG - Intronic
1056406853 9:86282851-86282873 CACCTTGCCCCGGGGGCAGGTGG - Intergenic
1056799833 9:89683356-89683378 CTCTTAGCCCCAGAGCCAGAGGG + Intergenic
1060208949 9:121699000-121699022 CCCCTCGCCCCGGCGCCCGGGGG + Intronic
1060594518 9:124840259-124840281 TACTTAGCCCCAGCTCCAGGTGG + Intergenic
1060917971 9:127402660-127402682 GACTCAGCACAGGCGCCAGGAGG + Exonic
1061677911 9:132228877-132228899 CACTTGCCCCCTGCGCCTGGAGG + Intronic
1188210737 X:27420059-27420081 CATTTCGCCCCAGCTCCAGGTGG + Intergenic
1197746401 X:129934346-129934368 CACTTACCCCAGGGGCCGGGGGG + Intergenic
1200401442 X:156022546-156022568 CACATAGGCCAGGAGCCAGGGGG + Intergenic