ID: 968015781

View in Genome Browser
Species Human (GRCh38)
Location 3:195331392-195331414
Sequence GTTCTCAGTGAGCCAAGATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3849
Summary {0: 1, 1: 1, 2: 48, 3: 1014, 4: 2785}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968015781_968015789 19 Left 968015781 3:195331392-195331414 CCCGATCTTGGCTCACTGAGAAC 0: 1
1: 1
2: 48
3: 1014
4: 2785
Right 968015789 3:195331434-195331456 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
968015781_968015785 10 Left 968015781 3:195331392-195331414 CCCGATCTTGGCTCACTGAGAAC 0: 1
1: 1
2: 48
3: 1014
4: 2785
Right 968015785 3:195331425-195331447 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
968015781_968015787 11 Left 968015781 3:195331392-195331414 CCCGATCTTGGCTCACTGAGAAC 0: 1
1: 1
2: 48
3: 1014
4: 2785
Right 968015787 3:195331426-195331448 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968015781 Original CRISPR GTTCTCAGTGAGCCAAGATC GGG (reversed) Intronic
Too many off-targets to display for this crispr