ID: 968018632

View in Genome Browser
Species Human (GRCh38)
Location 3:195363340-195363362
Sequence CTAATATTGTTAAAATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968018632 Original CRISPR CTAATATTGTTAAAATGTCC AGG Intronic
902051016 1:13563637-13563659 ATAATCTGGTTAAAATGTCTCGG - Intergenic
903505196 1:23829009-23829031 TTAATATTGTTAAAATGTCAGGG + Intronic
905046411 1:35006389-35006411 CTAATATGGTCAGAATATCCAGG - Intronic
905938440 1:41843344-41843366 CATATATTTTTAAAAGGTCCTGG + Intronic
908839007 1:68259464-68259486 GTAATATTATTAAAATATCCAGG - Intergenic
909035560 1:70591061-70591083 ATAATTTAGTTAAAATGTCTTGG - Intergenic
910096194 1:83524911-83524933 ATAATATTGTGAAAAGGGCCTGG - Intergenic
910125502 1:83837634-83837656 CTAAGATCCCTAAAATGTCCAGG + Intergenic
910787774 1:91019726-91019748 CTAAAAATGTAAAAATTTCCTGG - Intronic
910835369 1:91503161-91503183 CTAATATTCTGAAAATCTGCTGG + Intronic
911147894 1:94569809-94569831 ATAATTTGGTTAAAATGTCTCGG + Intergenic
913633065 1:120728331-120728353 ATACTATTTTTAAAATGTCTAGG - Intergenic
914285653 1:146224584-146224606 ATACTATTTTTAAAATGTCTAGG + Intronic
914546684 1:148675336-148675358 ATACTATTTTTAAAATGTCTAGG + Intronic
914619879 1:149395331-149395353 ATACTATTTTTAAAATGTCTAGG - Intergenic
916297112 1:163231509-163231531 TTACTATTGTTAAATTCTCCAGG - Intronic
916328952 1:163593778-163593800 ATAATTTAGTTAAAATGTCTTGG - Intergenic
917357213 1:174139024-174139046 ATAATATTGTTTACGTGTCCAGG - Intergenic
919195910 1:194286143-194286165 GTAATCTTGTTAAAATGTAAAGG + Intergenic
919230597 1:194768394-194768416 CTACTAGTGTTAATATTTCCTGG + Intergenic
920908101 1:210190055-210190077 ATAATTTGGTTAAAATGTCTCGG - Intergenic
921866557 1:220093380-220093402 ATAATATTGTTAAAATCTATGGG + Intergenic
921919408 1:220649547-220649569 CTAAGATTATTAAAATGTTTAGG - Intronic
922934913 1:229415141-229415163 ATAATTTAGTTAAAATGTCTTGG - Intergenic
923880226 1:238095644-238095666 CTAATATATTTAAAAGGTTCTGG + Intergenic
1063662924 10:8046239-8046261 CAGATATTGTTAAAATGTCAAGG + Intergenic
1064100394 10:12458726-12458748 CAAATATTGTTCAAAGGGCCAGG - Intronic
1064263444 10:13804856-13804878 CTATTAAGGTTAAAATGGCCTGG - Intronic
1064399167 10:15006481-15006503 CAAATATTTTTAACATGTCTCGG + Intergenic
1066511852 10:36108457-36108479 TTAATTTTTTTAAAATGTCTTGG + Intergenic
1068755127 10:60643997-60644019 CTAATGTAGTTAAAAGGGCCAGG - Intronic
1069002593 10:63282613-63282635 GTTATATTTTTAAAATGTACAGG + Intronic
1071921773 10:90358387-90358409 AAAAGATTGTTAAAAAGTCCTGG - Intergenic
1073394768 10:103208654-103208676 ATAATTTGGTTAAAATGTCTTGG - Intergenic
1073730672 10:106283943-106283965 TTAATAATATTCAAATGTCCTGG + Intergenic
1074230282 10:111527024-111527046 CTTATACTGTTAACATCTCCTGG - Intergenic
1075344080 10:121669707-121669729 CTAATTTTGTCAGAATCTCCAGG + Intergenic
1076565790 10:131398224-131398246 CTAGTTTTGTTACAGTGTCCTGG + Intergenic
1078789086 11:14525221-14525243 ATAATTTGGTTAAAATGTCTTGG - Intronic
1079449834 11:20590269-20590291 CAAACATTGTTAAAATGTGGAGG - Intergenic
1080000431 11:27342413-27342435 TTAATATTGACAAACTGTCCTGG - Intronic
1081277437 11:41167160-41167182 GTAATATTTTTGAAATGTTCTGG - Intronic
1082689126 11:56278275-56278297 TCAATATTGTTAAAATGCCTGGG - Intergenic
1082975555 11:59067771-59067793 ATATTAATGTTAAAATGCCCAGG + Intergenic
1083435818 11:62642356-62642378 CTGATATTGTTAAAAACTGCAGG - Intronic
1084226838 11:67721093-67721115 CAAATATTTTTAAAATGTCTCGG + Intergenic
1084808353 11:71595761-71595783 CAAATATTTTTAAAATGTCTCGG - Intronic
1084812489 11:71622375-71622397 CAAATATTTTTAAAATGTCTCGG - Intergenic
1084845459 11:71895770-71895792 CAAATATTTTTAAAATGTCTCGG - Intronic
1084926547 11:72517627-72517649 CTTAAATTGTTAAAATCCCCCGG - Intergenic
1086133246 11:83421877-83421899 ATAATTTAGTTAAAATGTCTCGG - Intergenic
1086360989 11:86059367-86059389 CAAATATTGTTAAACTGTAGTGG - Intronic
1086895359 11:92305749-92305771 CTAATACTCTTCAAATGTCAAGG + Intergenic
1087408244 11:97756327-97756349 CTAATATTTTAAATTTGTCCAGG + Intergenic
1088177717 11:107072866-107072888 CAAGTATTGTTAAGATGTCTTGG - Intergenic
1088572599 11:111237801-111237823 CTAATATGGCACAAATGTCCAGG - Intergenic
1089669785 11:120045898-120045920 CTCATAATATGAAAATGTCCAGG + Intergenic
1089866961 11:121640875-121640897 ATAATTTAGTTAAAATGTCTTGG + Intergenic
1090193055 11:124790192-124790214 GTAATATTGTGAAAAAGTCGGGG + Intronic
1090689430 11:129162326-129162348 ATAATATTTTTAAAATGTTGAGG + Intronic
1091468378 12:705311-705333 TAAAAATGGTTAAAATGTCCAGG - Intergenic
1092705452 12:11279199-11279221 CAAATATTGTAAAAATATCAAGG - Intergenic
1093539410 12:20263764-20263786 ATAATATTTTTATAATTTCCAGG - Intergenic
1094388860 12:29926804-29926826 ATAATAATTTTAAAATGGCCAGG - Intergenic
1094608396 12:31969597-31969619 CTAATATTGTGAATATGGCATGG - Intronic
1095778223 12:46032576-46032598 ATAATTTAGTTAAAATGTCTCGG - Intergenic
1096506755 12:52098563-52098585 CTGATATTGTTCCAATATCCAGG - Intergenic
1096881023 12:54670754-54670776 CTGATATTTTTTAAAGGTCCAGG - Intergenic
1096907106 12:54945879-54945901 ATAATCTAGTTAAAATGTCTTGG + Intergenic
1097216249 12:57415833-57415855 TTAATATTTTTGAAGTGTCCAGG - Intronic
1098747704 12:74260956-74260978 ATAATATTTTTAAAATTTTCAGG - Intergenic
1099616828 12:84946715-84946737 CAAATCTTATTAAAATTTCCAGG - Intergenic
1099872891 12:88370440-88370462 ATAATTTGGTTAAAATGTCTCGG - Intergenic
1102604575 12:114058603-114058625 ATAATTTGGTTAAAATGTCTTGG - Intergenic
1103873843 12:124111959-124111981 GTAATCATGTTAAAATGTCAGGG - Intronic
1105032316 12:132892474-132892496 ATAATTTGGTTAAAATGTCTCGG - Intronic
1105863742 13:24440544-24440566 CTAATATTTATCAAATATCCAGG + Intronic
1107263727 13:38526169-38526191 CTGATATAGTAAAAATGTCCTGG - Intergenic
1107470226 13:40684809-40684831 CTAATTTTTTTAAAACTTCCTGG + Intergenic
1107546474 13:41438137-41438159 CAAATATTTTTAAAATGTCTCGG + Intergenic
1107825061 13:44321576-44321598 CTAAGATGACTAAAATGTCCTGG - Intergenic
1109098565 13:58148667-58148689 TTCATATTTATAAAATGTCCTGG + Intergenic
1109700269 13:66015682-66015704 CTAATATTATAAACATTTCCTGG - Intergenic
1109787905 13:67205793-67205815 CGTATATTGATAAAATGTCTAGG - Intronic
1110845431 13:80186433-80186455 ATAATTTAGTTAAAATGTCTTGG - Intergenic
1110978578 13:81868935-81868957 ATAATTTAGTTAAAATGTCTTGG - Intergenic
1111482402 13:88848212-88848234 CTATTTTTGTTTAAATGTTCTGG + Intergenic
1111582833 13:90247602-90247624 TTAATATTCTTTAAATTTCCTGG + Intergenic
1112063310 13:95764051-95764073 CTAAAATTGTCAACATTTCCAGG - Intronic
1112634644 13:101201721-101201743 CTAAAAATGTTAAAATGTGGTGG + Intronic
1113232345 13:108226793-108226815 CTGATATTGTTCACTTGTCCTGG + Intronic
1114883536 14:26817248-26817270 CTAATACTATTAAAACATCCAGG - Intergenic
1114913186 14:27226728-27226750 CTAATATTGTTAAAACTACAAGG + Intergenic
1114966493 14:27967624-27967646 TCAATATTGTGAAAGTGTCCAGG - Intergenic
1115678775 14:35712666-35712688 CAAAAATTTTTAAAATGTGCTGG - Intronic
1116345576 14:43788776-43788798 TTAAAATAGTTAACATGTCCAGG - Intergenic
1116550762 14:46234803-46234825 CTAATAACGTCAAAATGTCTGGG - Intergenic
1117039773 14:51759325-51759347 CTAATGTTTTTAAAATGTCTCGG - Intergenic
1117041163 14:51770403-51770425 CAAATATTTTTAACATGTCTCGG + Intergenic
1120321940 14:82974593-82974615 CAAATATTGAAAAAGTGTCCTGG + Intergenic
1121193196 14:92047659-92047681 ATAATTTGGTTAAAATGTCTTGG + Exonic
1121718650 14:96094228-96094250 CTCATAGTGTTGAAATGTACCGG - Intergenic
1123882402 15:24688527-24688549 ATAATTTAGTTAAAATGTCTCGG + Intergenic
1126632658 15:50753366-50753388 CTAAGATATTTAAAATGTCATGG - Intronic
1127562297 15:60151469-60151491 CTAATGTTGCTAAAAATTCCAGG + Intergenic
1131295023 15:91140266-91140288 CTGGTACTGTTAAAATGTCAAGG - Intronic
1131708215 15:95021690-95021712 ATAATTATGTTAAAATCTCCAGG + Intergenic
1133535587 16:6699456-6699478 TTAATATTGTCAAAATGGCTTGG - Intronic
1133798002 16:9062217-9062239 CAAAAATTATTAAAATGGCCAGG - Intergenic
1134638285 16:15809234-15809256 TCAATATTGTTAGAATGACCGGG + Intronic
1137810785 16:51350552-51350574 TTAATATTGGTTAAAGGTCCAGG - Intergenic
1138142990 16:54584493-54584515 GAAATATTCTTAAAATGGCCGGG + Intergenic
1138759009 16:59520586-59520608 CTAATTTGGTTAAAATATCTCGG + Intergenic
1139204064 16:65008871-65008893 CTAATATAGTTAAAATTTACCGG + Intronic
1140326713 16:74011544-74011566 TTATTTTTATTAAAATGTCCTGG - Intergenic
1142933446 17:3308128-3308150 CAAATATTTTTAAAATGTTATGG - Intergenic
1143278479 17:5732202-5732224 CAAATACCTTTAAAATGTCCTGG - Intergenic
1143929536 17:10407543-10407565 CTAAAATTGTGAAACTGGCCAGG + Intronic
1149734838 17:58983593-58983615 CTAATATTTTTACAATCACCAGG - Exonic
1149752278 17:59157107-59157129 CTAATATTGTCAAATTCTCTTGG - Intronic
1203161279 17_GL000205v2_random:52967-52989 TTAATATTGTTAAGATGTCAGGG - Intergenic
1155835266 18:30574475-30574497 TTGATATGGCTAAAATGTCCTGG + Intergenic
1156690898 18:39705959-39705981 CTATTATTTTTAAAGTGTGCTGG + Intergenic
1156938627 18:42739413-42739435 ATAATTTAGTTAAAATGTCTTGG - Intergenic
1156982992 18:43314204-43314226 CTAATAGGTTTAAAATTTCCAGG + Intergenic
1157044407 18:44081997-44082019 ATAAAATAGTTAAAATATCCAGG + Intergenic
1157824044 18:50796458-50796480 ATAATATTGCTAGAATGTTCTGG + Intronic
1157906298 18:51572982-51573004 ATAATTTAGTTAAAATGTCTTGG + Intergenic
1158746531 18:60206413-60206435 AAAATATTGATCAAATGTCCTGG + Intergenic
1163935324 19:20437042-20437064 CTAATATTGTGAGAATTGCCAGG - Intergenic
1164003708 19:21130758-21130780 ATAATTTTGTTAAAATGTCTTGG - Intergenic
1164003998 19:21132728-21132750 ATAATTTTGTTAAAATGTCTTGG + Intergenic
1165510232 19:36262439-36262461 ATAATTTTGTTAAAATATCTCGG + Intergenic
1166226043 19:41396086-41396108 CAAATTTTGTTAAAATGTATTGG + Intronic
926964875 2:18398951-18398973 CTTATATTGCTCAAATGTCTGGG + Intergenic
928372903 2:30754045-30754067 CTTTTACTATTAAAATGTCCTGG + Intronic
928779616 2:34803912-34803934 ATAATTTAGTTAAAATGTCTTGG + Intergenic
930778075 2:55195419-55195441 TTAATATTGTTAAAATATCCAGG + Intronic
931519804 2:63083430-63083452 CTAAAATTTTTAAAATGTAATGG - Intergenic
931983602 2:67720729-67720751 TTAATATTGTTAATATGGTCTGG + Intergenic
932354416 2:71057510-71057532 CAAATATTTTTCAAATGTCTCGG - Intergenic
936935486 2:117835440-117835462 CTCTTTTTGTCAAAATGTCCAGG + Intergenic
937549598 2:123070980-123071002 ATAATATCTTTAAAGTGTCCAGG - Intergenic
938948699 2:136237719-136237741 GTAATATTGAAAAAGTGTCCAGG + Intergenic
939001173 2:136736798-136736820 CTTTTATGGTTAAAATGTGCTGG + Intergenic
939425655 2:142032894-142032916 CTGATAGTGTTAAAATGTAACGG - Intronic
940183784 2:150961070-150961092 ATAATTTGGTTAAAATGTCTCGG - Intergenic
940870464 2:158855924-158855946 CAAATATTTTTAAAATGTCTCGG - Intronic
940873171 2:158877048-158877070 CAAATATTTTTAACATGTCTCGG - Intergenic
942314372 2:174683799-174683821 ATCATATTGTTAAAATATCAAGG + Intergenic
943450217 2:188035971-188035993 ATAATTTAGTTAAAATGTCTTGG - Intergenic
943711897 2:191106324-191106346 CTAATTCTGTTTAAATGTCATGG + Intronic
944773327 2:202935750-202935772 ATAAAATTATTAGAATGTCCAGG - Intronic
946730209 2:222702187-222702209 CTGATATTTTTAAAGAGTCCAGG - Intronic
948267564 2:236646717-236646739 CTAATATTATCAAAAGGTCCTGG - Intergenic
1168906991 20:1413368-1413390 CTAAAATCATTAAAATGGCCAGG + Intergenic
1169180175 20:3557702-3557724 ATAAAATTTTTACAATGTCCAGG - Intronic
1169528139 20:6453202-6453224 TTAATATTATGAAAATGTTCAGG + Intergenic
1172238424 20:33394640-33394662 TAAAAATGGTTAAAATGTCCAGG - Intronic
1173672255 20:44806905-44806927 TTAATATTTTTAAAATGCCTGGG + Intronic
1176341512 21:5701694-5701716 TTAATATTGTTAAGATGTCAGGG + Intergenic
1176473766 21:7133847-7133869 TTAATATTGTTAAGATGTCAGGG + Intergenic
1176503315 21:7622762-7622784 TTAATATTGTTAAGATGTCAGGG - Intergenic
1182904580 22:33924076-33924098 CTAAAAATGGTAAAATGTTCCGG + Intergenic
1184299807 22:43551102-43551124 TTAATATGGTTGAACTGTCCTGG + Intronic
1203240778 22_KI270733v1_random:16160-16182 TTAATATTGTTAAGATGTCAGGG + Intergenic
950823616 3:15791175-15791197 TCAACACTGTTAAAATGTCCTGG + Intronic
951059657 3:18190256-18190278 CCAATATTGTTCAACTGTCAGGG - Intronic
951360515 3:21719304-21719326 GTCATATTGTTAAAGTGCCCTGG + Intronic
954984030 3:54773690-54773712 CTCATATTTTTAACATCTCCTGG - Intronic
955274944 3:57538224-57538246 CTAACATTGTGAACATATCCAGG + Intronic
955985652 3:64571655-64571677 CTAATATTGTTAAGATCTAAAGG + Intronic
956007776 3:64798911-64798933 CTGATATTGTTCAAGGGTCCAGG + Intergenic
956898957 3:73693658-73693680 CTAATCTTGTGAACATGTACTGG + Intergenic
956941743 3:74170100-74170122 CTAATATTTGTAAATTGCCCGGG - Intergenic
957043454 3:75355135-75355157 CAAATATTTTTAAAAAGTCTCGG + Intergenic
957616638 3:82537157-82537179 CTAATATTGTTATATGGTCCTGG - Intergenic
957641651 3:82861448-82861470 CTAATATTGCTGACATTTCCAGG - Intergenic
959768512 3:110063929-110063951 CTATTATTGTTGTAATTTCCAGG - Intergenic
960321882 3:116246840-116246862 CTCATACTTTGAAAATGTCCTGG + Intronic
961273207 3:125705701-125705723 CAAATATTTTTAACATGTCTCGG - Intergenic
961275949 3:125726857-125726879 CAAATATTTTTGAAATGTCTCGG - Intergenic
963468698 3:145713160-145713182 ATAATTTAGTTAAAATGTCTTGG - Intergenic
964058857 3:152495952-152495974 CTCATACTATCAAAATGTCCAGG + Intergenic
964553409 3:157910165-157910187 ATATTATTTTTAAATTGTCCAGG + Intergenic
964555880 3:157937984-157938006 CTATTTTTGTTAAAATGTATTGG + Intergenic
964983713 3:162715161-162715183 ATAATTTAGTTAAAATGTCTTGG - Intergenic
965070416 3:163910310-163910332 ATAATATAGTTAAAGTGTCTCGG - Intergenic
965416692 3:168403697-168403719 CTAATATTCTTAAAATGCTGTGG + Intergenic
966387810 3:179419949-179419971 CTAATATTTTTAAAAAATCTTGG - Intronic
968018632 3:195363340-195363362 CTAATATTGTTAAAATGTCCAGG + Intronic
968987890 4:3887941-3887963 CAAATATTTTTAAAATGTCTCGG + Intergenic
969018882 4:4125248-4125270 TAAATATTTTTAAAATGTCTCGG + Intergenic
969023527 4:4155124-4155146 CAAATATTTTTAAAATGTCTCGG + Intergenic
969026999 4:4181462-4181484 CAAATATTTTTAAAATGTCCCGG + Intergenic
969730285 4:8951957-8951979 CAAATAATTTTAAAATGTCTCGG - Intergenic
969735163 4:8983766-8983788 CAAATATTTTTAACATGTCTCGG - Intergenic
969786460 4:9461587-9461609 CAAATATTTTTAAAATGTCAAGG - Intergenic
969789888 4:9486069-9486091 CAAATATTTTTAAAATGTCTCGG - Intergenic
970820901 4:20212087-20212109 CTAATATTGTTAAAATGTTGAGG - Intergenic
971412589 4:26390756-26390778 CTAATATTGTTGAAATGGGCTGG + Intronic
971606389 4:28663682-28663704 ATATTATTGTTTAATTGTCCAGG + Intergenic
971614714 4:28773626-28773648 CAAATTTTGTTATAATGGCCAGG + Intergenic
972044355 4:34645973-34645995 CTAATAATGATAAAGTGTCTGGG + Intergenic
972071043 4:35019727-35019749 ATAATTTGGTTAAAATGTCTCGG + Intergenic
973005869 4:45006348-45006370 CTAAAATTATTAATATGTACAGG + Intergenic
973220776 4:47723653-47723675 ATAATATTTTCAAAATGCCCAGG + Intronic
973300454 4:48576712-48576734 GTAATAATGTTAAAATGATCTGG - Intronic
974173347 4:58294273-58294295 ATAATTTAGTTAAAATGTCTTGG + Intergenic
974181610 4:58390685-58390707 CTAAAATTTATAAAATGTCAAGG - Intergenic
974544256 4:63279763-63279785 CTAATTCTGTTAAAATGTCTTGG - Intergenic
974903865 4:68033375-68033397 ATAATTTAGTTAAAATGTCTCGG - Intergenic
976903009 4:90202921-90202943 ATTATTTTGTTAAAATGTCCAGG + Intronic
976954957 4:90884463-90884485 GTAAAATTATTAAAATCTCCAGG + Intronic
979171322 4:117603263-117603285 ATAATTTAGTTAAAATGTCTTGG + Intergenic
979453230 4:120897494-120897516 ATAATGTTTTTAAAAAGTCCTGG + Intronic
979931367 4:126635750-126635772 CTAATATTTATTAATTGTCCAGG - Intergenic
980111833 4:128643814-128643836 ATAATTTAGTTAAAATGTCTTGG + Intergenic
980170600 4:129284962-129284984 ATAACAATGTCAAAATGTCCTGG - Intergenic
980301556 4:131001487-131001509 TTAATATTATGAAAATGTCATGG - Intergenic
980491267 4:133532145-133532167 GTAATATAGTTAAAATGTCTCGG + Intergenic
982396637 4:154921790-154921812 ATAATTTAGTTAAAATGTCTTGG + Intergenic
982540137 4:156658576-156658598 CTAAAATCCTTAGAATGTCCAGG - Intergenic
982626211 4:157769629-157769651 CTAACATATTTAAAATGTCAGGG - Intergenic
983910241 4:173230802-173230824 ATAATATAGTTAGCATGTCCTGG + Intronic
984827983 4:183945023-183945045 GTAAAAGTGTTTAAATGTCCTGG + Intronic
988368399 5:30333311-30333333 TTACTATTGTTAAAATGACCAGG + Intergenic
989268098 5:39500731-39500753 CTAATTTTTTTTAAATGTGCTGG - Intergenic
989557198 5:42811400-42811422 CTAGTGTTGTAGAAATGTCCAGG - Intronic
989603593 5:43222832-43222854 CTAACATTTTTTTAATGTCCAGG - Intronic
990339792 5:54810798-54810820 GTAATATTATTATAATGACCAGG - Intergenic
992298047 5:75346401-75346423 ATAATATTGTTAAAATGGTTAGG - Intronic
993339082 5:86700152-86700174 CTTTTATTTTTAAAAAGTCCTGG + Intergenic
994835072 5:104840983-104841005 CTAATATTTTAAAAATGCACAGG + Intergenic
995168924 5:109083222-109083244 CAAATATTTTTAATATTTCCAGG + Intronic
996509986 5:124306551-124306573 ATAATTTAGTTAAAATGTCTTGG - Intergenic
997025496 5:130055785-130055807 ATCATCTTGTTAAAATGTCCGGG - Intronic
997157388 5:131574627-131574649 ATAATTTAGTTAAAATGTCTCGG - Intronic
997678720 5:135734316-135734338 ATAATTTAGTTAAAATGTCTTGG + Intergenic
998969170 5:147572570-147572592 CTAATATTTTTAATATGTCATGG - Intergenic
999211252 5:149891171-149891193 CTAAAATTGCTAAAATGGGCTGG + Intronic
1001068547 5:168561593-168561615 CTAATTTTATAAAAATATCCAGG - Intronic
1001816459 5:174673248-174673270 ATAAGAATGATAAAATGTCCTGG - Intergenic
1003237646 6:4311526-4311548 TTAATATTGTTATAATGACCAGG + Intergenic
1004973480 6:20937624-20937646 GTAATATTTTTGAAATGTGCTGG + Intronic
1007300883 6:40867154-40867176 ATAATTTGGTTAAAATGTCTCGG + Intergenic
1007555598 6:42763384-42763406 CAAATACTTTTAAAATGTCCTGG + Intronic
1008149038 6:47927662-47927684 CCCAGATTGATAAAATGTCCTGG - Intronic
1008150438 6:47943858-47943880 CTTATTTTGTCAAAATGTCAGGG + Intronic
1009357392 6:62768090-62768112 TTATTATTGTTAAAATGACCAGG + Intergenic
1009434640 6:63603854-63603876 AAAATATTATTAAAATGGCCGGG + Intergenic
1009771645 6:68151299-68151321 GTGAGAATGTTAAAATGTCCTGG - Intergenic
1010662404 6:78586148-78586170 ATAATTTGGTTAAAATGTCTCGG - Intergenic
1011866066 6:91829607-91829629 CTAATTATCTAAAAATGTCCAGG + Intergenic
1012663635 6:101937558-101937580 CTAAAATTTTTAGAATGTCAAGG - Intronic
1013732221 6:113181975-113181997 CTATTATTGCTCAAATGTCTAGG - Intergenic
1014315282 6:119856895-119856917 TTGATATTTTTAAAAAGTCCAGG + Intergenic
1015138655 6:129904069-129904091 ATAAAATTGTTATATTGTCCTGG - Intergenic
1016257764 6:142129402-142129424 CTAAAATTTTTAAAATGACCAGG - Intergenic
1017922732 6:158885979-158886001 ATAATTTGGTTAAAATGTCTTGG + Intronic
1020862873 7:13516424-13516446 CTAAGATTCTTATAATCTCCAGG - Intergenic
1021828661 7:24580328-24580350 TTTATATTGTTAAAATCCCCAGG + Intronic
1022055340 7:26726773-26726795 TTATTATTGTTAACATGTCAAGG + Intronic
1023536799 7:41222051-41222073 CAAATGTTGTTAAAATGTATTGG - Intergenic
1023885484 7:44350827-44350849 CTAATATAACCAAAATGTCCAGG + Intergenic
1024479100 7:49845701-49845723 TTAATTTTGTTACAATGTCAAGG - Intronic
1025151765 7:56560434-56560456 TCAATATTTTTAAAATTTCCTGG + Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1027653875 7:80904759-80904781 CTAGTGTTGTAAAACTGTCCAGG - Intronic
1028342528 7:89739350-89739372 AAAATATTCTTAAAATGTCCCGG + Intergenic
1028354800 7:89893707-89893729 GCAACATTGTTAAAATGTCTAGG - Intergenic
1028589813 7:92482735-92482757 ATAATTTGGTTAAAATGTCTCGG + Intergenic
1028882863 7:95899544-95899566 CTAATATATAAAAAATGTCCAGG - Intronic
1031297167 7:120015193-120015215 GTAATATTGTGGAAATGTCTTGG - Intergenic
1031704519 7:124963589-124963611 ATAATTTAGTTAAAATGTCTCGG + Intergenic
1034001745 7:147421531-147421553 TTAATATTATTAAAATATCTAGG + Intronic
1034288745 7:149910247-149910269 ATAATTTTCTTAAAATGTCATGG + Intergenic
1034662332 7:152782620-152782642 ATAATTTTCTTAAAATGTCATGG - Intronic
1036472245 8:9062387-9062409 ATAATTTAGTTAAAATGTCTTGG + Intronic
1036902676 8:12682782-12682804 CAAATATTTTAAAAATGTCTCGG + Intergenic
1037561677 8:20080768-20080790 CTCATATTGGTAAAATCTTCAGG - Intergenic
1038014643 8:23503750-23503772 CAAATTGTGTTAAAATGTCAGGG - Intergenic
1038109996 8:24485401-24485423 ATAAAATTGTTGTAATGTCCTGG + Intronic
1038234961 8:25744168-25744190 GTCTTAGTGTTAAAATGTCCAGG + Intergenic
1038830536 8:31054124-31054146 AAAATATTGTTAAAAAGTCTTGG + Intronic
1041308031 8:56483948-56483970 ATAATAATGTGTAAATGTCCTGG - Intergenic
1043999987 8:86867743-86867765 ATAATATTTTTAAAAAGCCCAGG + Intronic
1044450201 8:92326906-92326928 TTAATATTGTTAAAATGTTCAGG - Intergenic
1044954148 8:97462272-97462294 CTAATATCCTCCAAATGTCCAGG + Intergenic
1046319615 8:112555801-112555823 CTACTTTTGTCAAAAGGTCCAGG + Intronic
1049939363 9:530306-530328 TTATTATTTTTAAAATGTCCAGG + Intronic
1050622420 9:7468254-7468276 CTGATGTTATTAAAATGTGCTGG + Intergenic
1050810676 9:9742841-9742863 CTACTATTGCTAAAATCTCAAGG + Intronic
1050983557 9:12052530-12052552 CTTCTATTGATAAAATGTCTAGG - Intergenic
1051545027 9:18263991-18264013 TTAATTTAATTAAAATGTCCAGG - Intergenic
1051573691 9:18589170-18589192 TTAATATTGTTAACAAGACCAGG - Intronic
1055379230 9:75688192-75688214 CTAATAGAGTTACAAGGTCCTGG - Intergenic
1056916363 9:90749855-90749877 CAAATATTTTTAACATGTCTCGG + Intergenic
1057112684 9:92488807-92488829 ATCATGTTATTAAAATGTCCTGG - Intronic
1058379228 9:104360279-104360301 TTAATATTGTTAAAATGTATAGG + Intergenic
1061583162 9:131549842-131549864 ATAATTTGGTTAAAATGTCTCGG - Intergenic
1061769601 9:132908168-132908190 TTAATATTTTAAAAATTTCCTGG - Intronic
1186823616 X:13315767-13315789 CTGAAATTTTTAAAATATCCAGG + Intergenic
1187094565 X:16133275-16133297 CTATTATTTTTACATTGTCCAGG - Intronic
1188419588 X:29978099-29978121 ATAATTTAGTTAAAATGTCTTGG - Intergenic
1188884114 X:35529175-35529197 TTAATATTGTTAAAATGCCCAGG - Intergenic
1189031709 X:37458718-37458740 ATAATTTGGTTAAAATGTCTCGG + Intronic
1189511749 X:41669330-41669352 TTAATATGGAGAAAATGTCCAGG + Intronic
1191010961 X:55758588-55758610 CTAATAGTGTTTAAATGTACTGG + Intronic
1191960931 X:66701573-66701595 TCAATATTGTGAAAATGACCAGG + Intergenic
1192731433 X:73805862-73805884 ATAATTTGGTTAAAATGTCTTGG + Intergenic
1192735980 X:73850227-73850249 CTAATGTTTTAAAAATGTGCTGG - Intergenic
1192764490 X:74127759-74127781 ATAATTTAGTTAAAATGTCTCGG + Intergenic
1193860015 X:86653515-86653537 TCAATATTGTTAAAATAGCCAGG - Intronic
1194775200 X:97954602-97954624 GTAACATTGTTAATATCTCCAGG - Intergenic
1195474337 X:105267041-105267063 TAAATATTATTATAATGTCCTGG - Intronic
1195841582 X:109181182-109181204 CTAATTTGGTTAAAATATCTCGG - Intergenic
1196318658 X:114262317-114262339 CTAATATCGTTAAAATGATCAGG + Intergenic
1196774852 X:119328863-119328885 CTAATATGGTTAACGTGTGCTGG - Intergenic
1197597984 X:128490225-128490247 CTGATATTTTTTAAATGTCATGG - Intergenic
1197916080 X:131537070-131537092 CTAAAAGTGTTAAAAAGGCCAGG + Intergenic
1199093761 X:143717858-143717880 CTACTATTGTTAGAATGTATAGG - Intronic
1200360681 X:155603167-155603189 AAAATATTGTTAAAATAGCCAGG + Intronic
1201376585 Y:13329374-13329396 ATATTATTGTTAAAATTTCGAGG + Intronic
1201718165 Y:17069809-17069831 CTTAAAAAGTTAAAATGTCCAGG + Intergenic
1202062177 Y:20899334-20899356 ATAATTTGGTTAAAATGTCTTGG - Intergenic