ID: 968022922

View in Genome Browser
Species Human (GRCh38)
Location 3:195410890-195410912
Sequence CCTCAATGGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 480}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968022922_968022929 18 Left 968022922 3:195410890-195410912 CCTTCCACCTTCTGCCATTGAGG 0: 1
1: 0
2: 9
3: 52
4: 480
Right 968022929 3:195410931-195410953 ATCTTGAAAGCAGAGATAGCTGG 0: 1
1: 0
2: 1
3: 41
4: 300
968022922_968022927 -9 Left 968022922 3:195410890-195410912 CCTTCCACCTTCTGCCATTGAGG 0: 1
1: 0
2: 9
3: 52
4: 480
Right 968022927 3:195410904-195410926 CCATTGAGGACACATCAACAAGG 0: 1
1: 0
2: 3
3: 28
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968022922 Original CRISPR CCTCAATGGCAGAAGGTGGA AGG (reversed) Intronic
900587067 1:3437986-3438008 TAACAATGGCAGAAGGTGGCGGG - Exonic
900790269 1:4675376-4675398 CCTCAATGGGAGAGGATGGCCGG - Intronic
901221713 1:7587164-7587186 CCTCTGTGGCAGGAGGTGGGGGG + Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
903001325 1:20268109-20268131 CCTCAAAGGCTGCAGGGGGAGGG - Intergenic
905319379 1:37105122-37105144 CCTCAGTAGCAGCAGGTGGCAGG - Intergenic
905472130 1:38201146-38201168 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
906248412 1:44293198-44293220 CTTCAATGGCAGAAAGGGGTGGG + Intronic
906319435 1:44807233-44807255 GGCCAAAGGCAGAAGGTGGAAGG - Intergenic
908326680 1:63029999-63030021 CCTCAATGGGAGAAGAGGGATGG - Intergenic
908364789 1:63409830-63409852 CTTAAATGTCAGAATGTGGAGGG + Intronic
908499472 1:64728903-64728925 CTCACATGGCAGAAGGTGGAAGG - Intergenic
908860830 1:68486345-68486367 CAGTCATGGCAGAAGGTGGAGGG - Intronic
908932147 1:69330619-69330641 CCATCATGGCAGAAGGTGAAGGG + Intergenic
909247936 1:73312506-73312528 GATTAATGGCAGAAGGTGAAGGG - Intergenic
909468714 1:76002820-76002842 ATTCCATGGCAGACGGTGGAAGG + Intergenic
909529580 1:76667357-76667379 CAATAATGGCAGAAGGTGAAGGG + Intergenic
910111969 1:83692755-83692777 CCTTAAGGGTAGGAGGTGGAAGG - Intergenic
910508708 1:87979464-87979486 CCCCAATTACAGAATGTGGATGG - Intergenic
913144083 1:115972275-115972297 CTCACATGGCAGAAGGTGGAAGG + Intergenic
914897530 1:151690228-151690250 CATGAATGGCAGAAAGTCGAAGG - Intronic
915644894 1:157263080-157263102 CATCAATGTCAGAAGGCAGAAGG + Intergenic
916359233 1:163949476-163949498 CCATCATGGCAGAAGGTGAAGGG - Intergenic
916743794 1:167668773-167668795 CCTGAATGGGGGAAGGTGCATGG + Intronic
916893458 1:169136622-169136644 CATGAATGGCAGAAGAAGGAGGG - Intronic
917172214 1:172189776-172189798 CCACCATGGCAGAAGGTGAAAGG + Intronic
917512845 1:175682539-175682561 CCACAAGGGCAGAAGATGGTGGG - Intronic
918014523 1:180620174-180620196 TCCCAATGGCAGAAGGTGGAAGG - Intergenic
918961138 1:191279689-191279711 CTCACATGGCAGAAGGTGGAAGG + Intergenic
919001040 1:191831769-191831791 CTCAAGTGGCAGAAGGTGGAAGG + Intergenic
920294917 1:204950184-204950206 CCTCAGTGGCATCAGATGGAGGG + Intronic
920434857 1:205941097-205941119 CATCCATGGCAGGAGGAGGAAGG + Intronic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
920680223 1:208066498-208066520 CCACAATGCCACAAGGTGGTAGG - Intronic
923253110 1:232195211-232195233 CCTAAATGACACAAAGTGGATGG - Intergenic
923676857 1:236087876-236087898 CTCACATGGCAGAAGGTGGAAGG + Intergenic
924262803 1:242249278-242249300 ATTTCATGGCAGAAGGTGGAAGG - Intronic
1063009736 10:2010939-2010961 CCCAAATGGCAGAAGTGGGAAGG + Intergenic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1064934464 10:20664403-20664425 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1066148396 10:32587359-32587381 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1066725435 10:38387652-38387674 ATTTCATGGCAGAAGGTGGAAGG + Intergenic
1067141674 10:43663065-43663087 CCCTCATGGCAGAAGGTGAAGGG + Intergenic
1067196652 10:44125825-44125847 ACTCAATGGCAGTCAGTGGAGGG - Intergenic
1068852970 10:61765555-61765577 CATCCATTGCAGATGGTGGAGGG + Intronic
1069536794 10:69259693-69259715 CCATAATGGCAGAAGGTGAAGGG + Intronic
1070321299 10:75356718-75356740 CCTCAATGGGAGAACCTGGGTGG - Intergenic
1071177701 10:82945539-82945561 GTTCTATGGCAGAAGGGGGAAGG + Intronic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1071416347 10:85445221-85445243 CATCAATAGCAAGAGGTGGAAGG + Intergenic
1073142577 10:101258590-101258612 CATCACTGGCAGCAGGAGGATGG + Intergenic
1073417055 10:103392929-103392951 CCTCCATGGGAGAAGGGAGAAGG + Intronic
1075094265 10:119460780-119460802 CCTCAAGGGCAGAAGATGCAGGG + Intergenic
1076043573 10:127272780-127272802 CCATCATGGCAGAAGGTGAAGGG + Intronic
1076830535 10:132992224-132992246 CCTCGAGGACAGAGGGTGGACGG + Intergenic
1077561395 11:3263913-3263935 CTGCAATGGCAGAATTTGGAGGG - Intergenic
1077567291 11:3309742-3309764 CTGCAATGGCAGAATTTGGAGGG - Intergenic
1078080284 11:8199459-8199481 CCTCAATGGCCAGCGGTGGAGGG - Intergenic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1079399123 11:20091561-20091583 ACTCCATGGCAGAAGGTGGGAGG - Intronic
1079863951 11:25711695-25711717 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1081397434 11:42603370-42603392 CATCCTTGGCAGAAGGTAGAAGG + Intergenic
1082119137 11:48358919-48358941 CAGTAATGGCAGAAGGTGAAGGG + Intergenic
1082776910 11:57252505-57252527 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1082865745 11:57898685-57898707 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1082988063 11:59184946-59184968 CTGCAATGACAGAAGGTCGATGG - Intronic
1083191290 11:61054136-61054158 CCTCAAAGACAGTATGTGGATGG + Intergenic
1083459497 11:62801367-62801389 CCTGAATCGCAGAAGCTGTATGG - Exonic
1083523855 11:63342433-63342455 CATCCCTGGAAGAAGGTGGAAGG + Intronic
1083552003 11:63597158-63597180 CCATCATGGCAGAAGGTGAAGGG - Intronic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1084104245 11:66970632-66970654 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1084776271 11:71378739-71378761 CAACCATGGCAGAAGGTGAAGGG - Intergenic
1085959233 11:81440170-81440192 CTTACATGGCAGCAGGTGGAAGG + Intergenic
1087401765 11:97675866-97675888 CTAACATGGCAGAAGGTGGAAGG + Intergenic
1087497182 11:98906793-98906815 CCGTCATGGCAGAAGGTGAAGGG - Intergenic
1087829868 11:102807989-102808011 CCTCCACGGCGGAAGGTGGCAGG + Intergenic
1088320343 11:108549063-108549085 TCTCATTGGCATAAAGTGGATGG - Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088626088 11:111731686-111731708 CCACACTGGCAGAGGCTGGAAGG + Intronic
1089107901 11:116029947-116029969 ATTCCATGGCAGAAGGTGGAAGG - Intergenic
1089794220 11:120967340-120967362 CCTCTAGGGCAGGAGGAGGATGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090729323 11:129556015-129556037 CTCCCATGGCAGAAGGTGAAAGG - Intergenic
1090805642 11:130200393-130200415 CATCCATGGCAGAAGGTGAAGGG + Intronic
1090939344 11:131373653-131373675 TCTCAGTGGCAGAAGGTGGGCGG - Intronic
1092103919 12:5907536-5907558 CCCCAAAGGGAGAAGGTGCAGGG - Intronic
1092925427 12:13267959-13267981 CAACCATGGCAGAAGGTGAAGGG + Intergenic
1093009702 12:14093663-14093685 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1093211949 12:16318325-16318347 CCTCAGTTCCACAAGGTGGAAGG - Intergenic
1094128137 12:27045288-27045310 CAACCATGGCAGAAGGTGAAGGG + Intronic
1094383417 12:29868068-29868090 CCATTATGGCAGAAGGTGAAAGG - Intergenic
1094738701 12:33264102-33264124 CCTCTATGGCATAAGGTGGAAGG - Intergenic
1095213835 12:39526005-39526027 CAACCATGGCAGAAGGTGAAAGG + Intergenic
1095633234 12:44402083-44402105 CAACCATGGCAGAAGGTGAAAGG + Intergenic
1096685902 12:53288145-53288167 CCTGAATGGCAGGAGCCGGAGGG + Exonic
1097335433 12:58377517-58377539 CAGCCATGGCAGAAGGTGAAGGG - Intergenic
1097574136 12:61370154-61370176 CTCACATGGCAGAAGGTGGATGG - Intergenic
1098348588 12:69532503-69532525 CTTGCATGGCAGAAGGTGGAGGG + Intronic
1098393009 12:69989392-69989414 CCTCAAGGGAGGAAGGTGGAAGG + Intergenic
1098511293 12:71316921-71316943 TCACATTGGCAGAAGGTAGAAGG - Intronic
1098651772 12:72979587-72979609 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1099513775 12:83570393-83570415 TTTCCATGGCAGAAAGTGGAAGG + Intergenic
1099621663 12:85009121-85009143 CTCCCATGGCAGAAGGTGAAAGG + Intergenic
1099668590 12:85661067-85661089 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1099722437 12:86381931-86381953 CAACCATGGCAGAAGGTGAAAGG - Intronic
1099902346 12:88727356-88727378 CCTTTATGGCAGAAGGGGAAGGG - Intergenic
1100118171 12:91335066-91335088 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1100234050 12:92639837-92639859 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1101049122 12:100842732-100842754 CTTACATGGTAGAAGGTGGAAGG + Intronic
1101080083 12:101173007-101173029 CATCAAGGGCTGAAGGTGGCTGG - Intronic
1101103337 12:101416994-101417016 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1101990450 12:109479907-109479929 CCTCAATGGCAGAGGGTCCATGG - Intronic
1102275055 12:111575561-111575583 CCTCAATGCCATAAGGTGGCAGG + Intronic
1104198988 12:126568689-126568711 CCTCAAAGTCAGAGTGTGGAAGG + Intergenic
1104722153 12:131050545-131050567 CAGTCATGGCAGAAGGTGGAGGG + Intronic
1105446990 13:20466017-20466039 CACCCATGGCAGAAGGTGAAGGG - Intronic
1105709216 13:22990036-22990058 CAATCATGGCAGAAGGTGGAAGG - Intergenic
1105771774 13:23618924-23618946 CTTACGTGGCAGAAGGTGGAAGG - Intronic
1106208927 13:27622895-27622917 CCTCAATGGCTGAAGGCGAGAGG + Exonic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1107043757 13:35974648-35974670 CAACCATGGCAGAAGGTGAAAGG - Intronic
1107664494 13:42674895-42674917 CCTCAGTGAGAGCAGGTGGAAGG - Intergenic
1107719057 13:43229171-43229193 CAATCATGGCAGAAGGTGGAAGG - Intronic
1108112416 13:47089885-47089907 ACTCCATGGCTAAAGGTGGAAGG + Intergenic
1108196959 13:48004446-48004468 CCCAAATGGCAGAGGGTGAATGG - Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1109579460 13:64307932-64307954 CCATCATGGCAGAAGGTGAAGGG + Intergenic
1110439967 13:75516880-75516902 CCATAGTGGCAGAAGGTGGAAGG - Intergenic
1111606652 13:90547514-90547536 CCTAAATGTCAGAAGATGTATGG - Intergenic
1111807813 13:93059636-93059658 CAACCATGGCAGAAGGTGAAAGG - Intergenic
1111956689 13:94766694-94766716 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1112248351 13:97754821-97754843 CCCACCTGGCAGAAGGTGGAGGG + Intergenic
1112460120 13:99596520-99596542 CAACCATGGCAGAAGGTGAAGGG - Intergenic
1113205086 13:107907676-107907698 CACCCATGGCAGAAGGTGAAGGG - Intergenic
1114975945 14:28099734-28099756 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1115134462 14:30091932-30091954 CAATAATGGCAGAAGGTGAAGGG + Intronic
1115418830 14:33168753-33168775 CGTGAATGGCAGAAGGAAGAGGG - Intronic
1115962699 14:38853473-38853495 CAATAATGGCAGAAGGTGAAAGG - Intergenic
1116369523 14:44111312-44111334 CCTCAAGAGGATAAGGTGGAAGG - Intergenic
1116420523 14:44727034-44727056 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1116972788 14:51084406-51084428 CCATAATGGCAGAAGGTAGCCGG + Intronic
1117514315 14:56485398-56485420 CTTACATGGCAGAAGATGGAAGG + Intergenic
1118039620 14:61902758-61902780 CCATCATGGCAGAAGGTGAAAGG + Intergenic
1118050891 14:62026429-62026451 CTCACATGGCAGAAGGTGGAAGG + Intronic
1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG + Intergenic
1118627340 14:67671781-67671803 ACCCCATGGCAGAAGATGGAAGG + Intronic
1118782561 14:69018664-69018686 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1118859519 14:69651659-69651681 CCACAATGGGAGAAGATAGAAGG + Intronic
1119577960 14:75745100-75745122 CATCACTGGCAGAGAGTGGACGG - Exonic
1119604328 14:76001799-76001821 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1121167351 14:91818052-91818074 CCTCAAGGGAGTAAGGTGGAAGG - Intronic
1121211880 14:92213388-92213410 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1121384634 14:93509062-93509084 CAATAATGGCAGAAGGTGCAGGG + Intronic
1121420984 14:93814069-93814091 ATTCCATGGCAGAAGGTGGAAGG + Intergenic
1121461875 14:94086238-94086260 CGATCATGGCAGAAGGTGGAAGG - Intronic
1122057949 14:99117861-99117883 CCTCAAAGGCAGCAAGGGGACGG - Intergenic
1122442262 14:101740193-101740215 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1122448488 14:101784443-101784465 CCATCATGGCAGAAGGTGAAGGG + Intronic
1123811879 15:23935214-23935236 ACTCAATAGCAGAAGGTAAAGGG - Intergenic
1124529894 15:30496559-30496581 GCTCAATAGTAGAGGGTGGAGGG + Intergenic
1124768765 15:32511129-32511151 GCTCAATAGTAGAGGGTGGAGGG - Intergenic
1126713053 15:51483222-51483244 GCTCACTGGCGGTAGGTGGAGGG - Intronic
1126804519 15:52333008-52333030 CTTACATGGCAGAAGGTGGAAGG - Intronic
1127492084 15:59474407-59474429 CTTACATGGCAGAAGGTGGAAGG + Intronic
1128564062 15:68687769-68687791 ATCCCATGGCAGAAGGTGGAGGG + Intronic
1129279963 15:74476906-74476928 CCAACATGGCAGAAGGTGAAAGG + Intergenic
1130120782 15:81045831-81045853 CAACCATGGCAGAAGGTGAAGGG - Intronic
1131130266 15:89894470-89894492 CCTCTATGGTAGACGGTGAATGG + Intronic
1131975287 15:97939752-97939774 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1132238545 15:100239901-100239923 CTTCACTGGCTGAGGGTGGAGGG - Intronic
1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG + Intronic
1133931562 16:10236847-10236869 CTCCAATGGCAGAAGCTGCAAGG + Intergenic
1134285672 16:12860155-12860177 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1135847687 16:25933739-25933761 CAACCATGGCAGAAGGTGAAAGG + Intronic
1135933561 16:26760052-26760074 TCTCATTGGCATGAGGTGGAAGG - Intergenic
1136623494 16:31446090-31446112 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1137025982 16:35475069-35475091 CTTCAATGGCAGAAGGGACAAGG - Intergenic
1137469731 16:48743564-48743586 CCTCAGTGACAGAAGGTGGTTGG - Intergenic
1138331772 16:56221109-56221131 CTCCCATGGCAGAAGGTAGAAGG - Intronic
1138897010 16:61218846-61218868 CAACACTGGCAGAAGCTGGAGGG - Intergenic
1140237712 16:73173834-73173856 CCTGTATGGCAGAAAGGGGAAGG + Intergenic
1140348018 16:74233795-74233817 CTCCTATGGCAGAAGGTGGATGG - Intergenic
1140491446 16:75339646-75339668 CCTAAAGGGCAGAAGGCTGAGGG - Intronic
1140794820 16:78427463-78427485 CCTCAATGGCTGCAGCTGCATGG + Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141793908 16:86256590-86256612 CCTCATTGTCAGCAGGGGGAGGG + Intergenic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1142789159 17:2249872-2249894 CACCAATGGCAGTAGATGGATGG + Intronic
1142798874 17:2331570-2331592 CAATCATGGCAGAAGGTGGAGGG - Intronic
1143312210 17:6001724-6001746 CCACTATGGGAGAAGATGGATGG - Intronic
1143643572 17:8214475-8214497 CCCCCATTTCAGAAGGTGGAAGG - Intergenic
1143963793 17:10741610-10741632 TGTCAATGGCAGAAGGAGGCTGG + Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1147457534 17:40547591-40547613 CCACCATGGCAGCAGGTGGAGGG - Intergenic
1147952016 17:44112652-44112674 CCTGACTGGCAGAAGCTGGCTGG - Intronic
1150449646 17:65256189-65256211 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1150470370 17:65432079-65432101 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1150770178 17:68034358-68034380 CCTAAATGCAAGAATGTGGAAGG - Intergenic
1151082553 17:71345357-71345379 ATTCCATGGCAGAAGATGGAAGG - Intergenic
1152003921 17:77665312-77665334 CAATTATGGCAGAAGGTGGAAGG - Intergenic
1152029546 17:77833474-77833496 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1152196768 17:78923251-78923273 CCAGGATGGCAGAGGGTGGAGGG - Intronic
1152507030 17:80756241-80756263 ATCCCATGGCAGAAGGTGGAAGG - Intronic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1155144345 18:23070947-23070969 CCTCTATGGTAGGTGGTGGAAGG - Intergenic
1155162032 18:23203913-23203935 CCTCAGTGGCAGAAGGCGGCAGG + Intronic
1155205119 18:23551937-23551959 CATCAATGGCACATGGTGCATGG + Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155668325 18:28337875-28337897 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1155868585 18:30997340-30997362 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1156402706 18:36755146-36755168 CCCGAATTGCATAAGGTGGATGG - Exonic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1157910220 18:51610472-51610494 CAACCATGGCAGAAGGTGAATGG + Intergenic
1158015477 18:52777864-52777886 TATCTATGGCAGAAGGTAGATGG + Intronic
1158094511 18:53755531-53755553 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1159898911 18:74023603-74023625 CACCACTGGCAGAAGGTGAAGGG - Intergenic
1160080222 18:75719588-75719610 CCATCATGGCAGAAGGTGAAGGG + Intergenic
1160096146 18:75875557-75875579 TCTAACTGGCAGAAGGTGGTGGG - Intergenic
1161062310 19:2221446-2221468 CCTCATTGGCAGAAGCAGGGAGG + Intronic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1162424184 19:10584062-10584084 GATCAATGGCTGAGGGTGGAAGG + Exonic
1162718092 19:12646624-12646646 GTTCAATGGAAGGAGGTGGATGG - Exonic
1164468037 19:28504947-28504969 CCTCTAGAGCAGAAGGTGGGAGG - Intergenic
1165026988 19:32969459-32969481 CATGAATGGCAGCAGGAGGAAGG - Intronic
1167986799 19:53325247-53325269 CATGGATGGCAGAAGGGGGATGG - Intergenic
1168134520 19:54341513-54341535 TCTCCATGGCAGAGGCTGGAGGG + Intergenic
925669051 2:6292137-6292159 CAATAATGGCAGAAGGTGAAAGG - Intergenic
926520919 2:13912023-13912045 ACACCATGGCAGAAGGTGAAGGG - Intergenic
927218286 2:20682584-20682606 CCTCCCTGGCAAAAGGTGGAAGG + Intergenic
928811342 2:35231064-35231086 CATTCATGGCAGAAGGTGAAGGG - Intergenic
929346928 2:40895654-40895676 CTACCATGGTAGAAGGTGGAAGG + Intergenic
930511660 2:52352875-52352897 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931831190 2:66053178-66053200 CATCCATGGCAGAAGGCAGAGGG + Intergenic
932232533 2:70094595-70094617 TCTCACTGGCAGGAGGTGGCAGG - Intergenic
933031356 2:77333106-77333128 CAATAATGGCAGAAGGTGAAAGG - Intronic
933685831 2:85140481-85140503 CCTCCATGGTGGAAGCTGGAGGG + Intronic
933732340 2:85466798-85466820 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
934652056 2:96098417-96098439 CCTCCTTGGCAGAACGAGGAAGG + Intergenic
934777382 2:96948177-96948199 CCCCCATGCCAGGAGGTGGACGG - Intronic
935481326 2:103593870-103593892 CAATAATGGCAGAAGGTGAAAGG - Intergenic
935789261 2:106576052-106576074 CCACAGTGGCAGATGGAGGATGG - Intergenic
936800164 2:116256971-116256993 CCATCATGGCAGAAGGTGAAGGG + Intergenic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
938509208 2:131922787-131922809 GCTCAATGGCAGAGTGGGGATGG - Intergenic
938730635 2:134144295-134144317 CCATCATGGCAGAAGGTGAAGGG + Intronic
939208566 2:139141040-139141062 CATCAAGGGATGAAGGTGGAGGG + Intergenic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940298869 2:152158783-152158805 CTTACATGGCAGAAGGTAGAAGG + Intronic
940488753 2:154329864-154329886 CAACCATGGCAGAAGGTGAAAGG - Intronic
940515844 2:154683094-154683116 CTCCCATGGCAGATGGTGGATGG - Intergenic
941915922 2:170813916-170813938 GCTCAAAGGCAGAAGAAGGAGGG - Intronic
942211948 2:173680017-173680039 ACCCCATGGCAGAAGGTAGAAGG - Intergenic
942482531 2:176404570-176404592 CAATAATGGCAGAAGGTGAAAGG + Intergenic
942770420 2:179511320-179511342 TCTAAATGGCAGATGGTAGATGG + Intronic
942970198 2:181949429-181949451 CATTCATGGCAGAAGGTGAATGG + Intergenic
943107204 2:183560427-183560449 CAATAATGGCAGAAGGTGAAAGG + Intergenic
943971844 2:194419794-194419816 CATCAAGGGCAGAAGTAGGAAGG + Intergenic
944303453 2:198152138-198152160 CCAGAAGGGCAAAAGGTGGAAGG + Intronic
944681774 2:202084014-202084036 CCTCTAGGGGAGAAGGTGCAGGG + Intronic
945084274 2:206115449-206115471 CTCCCATGGCAGAAGATGGAAGG - Intronic
945386003 2:209202004-209202026 GCACCATGGCAGAAGGTAGATGG + Intergenic
946503604 2:220275901-220275923 CAATAATGGCAGAAGGTGAACGG + Intergenic
947008299 2:225537435-225537457 ACACCATGGCAGAAGGTGAAAGG + Intronic
947769516 2:232659850-232659872 CAACCATGGCAGAAGGTGAAGGG + Intronic
948710854 2:239824689-239824711 CAATCATGGCAGAAGGTGGAAGG - Intergenic
1168957456 20:1844421-1844443 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1169567326 20:6869274-6869296 CCGAAAGGGCAGAAGTTGGAGGG + Intergenic
1169624745 20:7552669-7552691 CCCACATGGCAGAAGATGGAAGG + Intergenic
1170216735 20:13899547-13899569 CTTCCCTGGCAGAGGGTGGAAGG + Intronic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1171524869 20:25800943-25800965 CTCACATGGCAGAAGGTGGAAGG + Intronic
1171551958 20:26054940-26054962 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1173089325 20:39955310-39955332 CCTCCATGGCAGAAGGGCTAGGG + Intergenic
1173491754 20:43488277-43488299 CAACCATGGCAGAAGGTGAAAGG + Intergenic
1174358528 20:50014145-50014167 CCACAGTGGCAGTAGCTGGACGG - Intergenic
1175169482 20:57070157-57070179 CATCAATGCCAGGAGGGGGAGGG - Intergenic
1175188316 20:57194871-57194893 ACTCATTGGCAGATGGTGCAGGG - Intronic
1175531922 20:59679698-59679720 CAATAATGGCAGAAGGTGAAAGG + Intronic
1177408470 21:20699977-20699999 CAATAATGGCAGAAGGTGAAAGG - Intergenic
1177982326 21:27929614-27929636 GCTCAATGGCAGAGTGGGGATGG + Intergenic
1178058900 21:28830399-28830421 CCGTCATGGCAGAAGGTGAAGGG - Intergenic
1178178440 21:30132032-30132054 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1179097961 21:38332493-38332515 CCCCCATGGCAGAAGGTGGAAGG + Intergenic
1179266549 21:39808405-39808427 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1180278514 22:10669153-10669175 TCTCATTGGAAGAAGGGGGAAGG + Intergenic
1180677355 22:17596482-17596504 CACTCATGGCAGAAGGTGGAAGG - Intronic
1181018930 22:20088128-20088150 CCTCAATGGCCCAAGGAGGATGG - Intronic
1181061379 22:20283674-20283696 CCTGAAAGGCGGATGGTGGAAGG - Intergenic
1181987894 22:26813902-26813924 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1182054413 22:27338662-27338684 ATTCCATGGTAGAAGGTGGAAGG - Intergenic
1182536878 22:31010427-31010449 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1183747006 22:39697852-39697874 CCTCATTCGCAGAAGCAGGAAGG - Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
1184909317 22:47515959-47515981 CCTCAATGGCAGAAATGGGTAGG - Intergenic
1184914069 22:47555555-47555577 CAATCATGGCAGAAGGTGGAGGG + Intergenic
950240485 3:11365683-11365705 CCTAGCTGGCAGAAGGTGGGTGG - Intronic
950419999 3:12892883-12892905 GCACAATGGGAGAGGGTGGAGGG - Intergenic
950455026 3:13087817-13087839 CTCCCGTGGCAGAAGGTGGAAGG + Intergenic
951237406 3:20251732-20251754 CCACCATGGTAGAAGGTGAAAGG + Intergenic
952494447 3:33903617-33903639 CTGCTGTGGCAGAAGGTGGAAGG + Intergenic
953503481 3:43460479-43460501 CCCCAATGCCAGAATGTGGAAGG - Intronic
953973155 3:47362641-47362663 CCATCATGGCAGAAGGTGAAAGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
956035027 3:65081227-65081249 CCTCACTGGCAGAATATGAAAGG - Intergenic
956234889 3:67058706-67058728 TCTTCATGGCAGAAGGTGAAAGG + Intergenic
956235696 3:67068754-67068776 CAAAAATGGCAGAAGGTGAAAGG + Intergenic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
956758358 3:72412960-72412982 CTCACATGGCAGAAGGTGGAAGG - Intronic
957703769 3:83753358-83753380 CCACCATGGCAGAAGGTGGAAGG + Intergenic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
960145049 3:114192003-114192025 GCTCAATGGCAGAGAGAGGAGGG + Intronic
960861312 3:122156723-122156745 CAACCATGGCAGAAGGTGAAGGG - Intergenic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG + Exonic
962487941 3:135863067-135863089 TCCCACTGGCGGAAGGTGGAAGG - Intergenic
964570519 3:158104562-158104584 CCTCATTGGCAGAATTTGAAGGG - Intronic
964732476 3:159882098-159882120 TCTCAATGGGAGAAGCTGCAGGG + Intronic
964810598 3:160659717-160659739 ACTTCATGGCAGAAGGTAGAAGG - Intergenic
965218193 3:165892351-165892373 CATTTATGGCAGAAGGTGAATGG + Intergenic
966338704 3:178901267-178901289 ATCCCATGGCAGAAGGTGGATGG - Intergenic
966393236 3:179475026-179475048 ATCCAATGGCAGGAGGTGGAAGG + Intergenic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968085587 3:195872548-195872570 CCACTGTGGCAGAAGGGGGATGG + Intronic
969905321 4:10388394-10388416 CAACCATGGCAGAAGGTGAAGGG + Intergenic
969920555 4:10535348-10535370 ACTCAATGGCCAAAGGTGCAGGG - Intronic
970475259 4:16415647-16415669 CAACCATGGCAGAAGGTGAAGGG - Intergenic
970704285 4:18782076-18782098 CAACCATGGCAGAAGGTGAAGGG + Intergenic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
971272749 4:25166045-25166067 CTCACATGGCAGAAGGTGGAAGG - Intronic
971632924 4:29018183-29018205 CAATAATGGCAGAAGGTGAAGGG - Intergenic
971818634 4:31523043-31523065 TCTCAATGGCAGAGAGTAGAAGG - Intergenic
971945671 4:33273530-33273552 CTCACATGGCAGAAGGTGGAAGG - Intergenic
972227972 4:37036239-37036261 CAATAATGGCAGAAGGTGAAAGG + Intergenic
972296649 4:37745646-37745668 CCATCATGGCAGAAGGTGAAGGG + Intergenic
972395883 4:38659613-38659635 CTTGCATGGCAGAAGGTGAAGGG + Intergenic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
974388997 4:61240194-61240216 CCTCACTGGTGGAAAGTGGAAGG + Intronic
974846215 4:67353513-67353535 CTCCCATAGCAGAAGGTGGAAGG + Intergenic
975351323 4:73350614-73350636 CATTCATGGCAGAAGGTGAAGGG + Intergenic
976270403 4:83224721-83224743 ACCCCATGGCAGAGGGTGGAAGG - Intergenic
977659316 4:99564091-99564113 CCGCAATGGAAGAAAGGGGAGGG + Exonic
977681321 4:99801555-99801577 CCTGAATTCCAAAAGGTGGAGGG + Intergenic
977706780 4:100080435-100080457 ATCCAATGGCAGAAGGTGTAAGG + Intergenic
977772642 4:100878123-100878145 CATTCATGGCAGAAGGTGAAGGG + Intronic
978408496 4:108404784-108404806 CAATAATGGCAGAAGGTGAAGGG + Intergenic
978417120 4:108488340-108488362 CAATCATGGCAGAAGGTGGAAGG + Intergenic
978920160 4:114174465-114174487 CAACCATGGCAGAAGGTGAAAGG + Intergenic
979078530 4:116304627-116304649 CCATCATGGCAGAAGGTGAAAGG - Intergenic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
980843148 4:138291190-138291212 TTTCAATGGGAGAAGGGGGAGGG - Intergenic
981185776 4:141801200-141801222 CTGAAATGGCGGAAGGTGGAAGG + Intergenic
981356734 4:143798234-143798256 CGTTCATGGCAGAAGGTGAAGGG + Intergenic
981698358 4:147581523-147581545 CTCACATGGCAGAAGGTGGAAGG - Intergenic
982331361 4:154185192-154185214 CCTACATGGCAGAAGGCAGAGGG - Intergenic
983489060 4:168367411-168367433 CCATCATGGCAGAAGGTGAAAGG - Intronic
983500635 4:168495390-168495412 CTCACATGGCAGAAGGTGGAAGG - Intronic
983903677 4:173163401-173163423 CCTCACTGGCAGGCGGTGGGAGG - Intergenic
983927644 4:173418869-173418891 CAACCATGGCAGAAGGTGAAGGG - Intergenic
984011947 4:174381961-174381983 CATGTATGGTAGAAGGTGGAGGG + Intergenic
984878472 4:184390175-184390197 GCACAATGGCAGAAAGTGGCTGG - Intronic
985786020 5:1895321-1895343 CCATCATGGCAGAAGGTGAAAGG - Intergenic
986409005 5:7457616-7457638 CCTAAATGGGACAAGGTGCAGGG + Intronic
986860480 5:11921348-11921370 CCATCATGGCAGAAGGTGAAAGG - Intergenic
987597532 5:20020688-20020710 CCTCAATTTCAGAGGGTGTATGG + Intronic
988519371 5:31931936-31931958 CATTAATGGCAGAAGTTGGAAGG + Intronic
988839782 5:35072268-35072290 CTTAAATGGCACAAGGTGGGAGG - Intronic
989375098 5:40752977-40752999 CCGTAATGGCAGAATTTGGAGGG + Intronic
991221526 5:64224900-64224922 CTCACATGGCAGAAGGTGGAAGG - Intronic
991484845 5:67124189-67124211 ACCCAAGGGTAGAAGGTGGAGGG - Intronic
992255525 5:74917202-74917224 TCTCATTGGCAGGAAGTGGAAGG - Intergenic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
993744915 5:91585540-91585562 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
994315368 5:98326884-98326906 ACTCAAAGACAGAGGGTGGAAGG - Intergenic
995514091 5:112937113-112937135 CCCACATGGCAGAAGGTGGGAGG - Intergenic
996182191 5:120432577-120432599 CTCACATGGCAGAAGGTGGAAGG - Intergenic
996509058 5:124298745-124298767 CAACCATGGCAGAAGGTGAAGGG + Intergenic
997081715 5:130747051-130747073 CCTAGATGTCAGAAGGTGTATGG + Intergenic
997211272 5:132078427-132078449 ACTCACTGACACAAGGTGGAGGG + Intergenic
997740623 5:136250166-136250188 CCAAAATGGCAGAGGGTGGGTGG + Intronic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
998487552 5:142516331-142516353 CATTCATGGCAGAAGGTGAAGGG - Intergenic
998656196 5:144182236-144182258 CATCCATGCCAGAAGGTGAAGGG - Intronic
999052051 5:148533518-148533540 CCTTAATTGCAGAAGGAGCACGG - Intronic
999623741 5:153498492-153498514 CCTCAATGACAATAGGTGAAAGG + Intronic
999895446 5:156027941-156027963 CTCATATGGCAGAAGGTGGAAGG + Intronic
1000521720 5:162302880-162302902 CTTTAATGGCAGAAGGCAGAAGG + Intergenic
1001858166 5:175030824-175030846 CCTAAAAGGTAGATGGTGGAAGG + Intergenic
1001947233 5:175789838-175789860 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1002525966 5:179816459-179816481 TTTCGATGGCAGCAGGTGGAGGG + Intronic
1002774642 6:318441-318463 CCTCAATGGCTGCTGGAGGAGGG - Intronic
1003058328 6:2842319-2842341 CCTCAATGGTGGAAAGTGGAAGG + Intergenic
1003769022 6:9276505-9276527 TCTCAATGTCAGAAAGTGAAGGG + Intergenic
1003953566 6:11141613-11141635 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1004296411 6:14415863-14415885 CCATCATGGCAGAAGGTGAAGGG - Intergenic
1004994962 6:21181474-21181496 ATCCAATGGCAGAAGGTAGAAGG - Intronic
1005167208 6:22938423-22938445 CCATCATGGCAGAAGGTGAAGGG + Intergenic
1005256126 6:24005205-24005227 CATTCATGGCAGAAGGTGAAGGG + Intergenic
1005513127 6:26530013-26530035 CCTGATTGGGCGAAGGTGGAAGG - Intergenic
1005671775 6:28113596-28113618 ATTCTATGGCAGAAGGTGGAGGG - Intergenic
1006698095 6:35948913-35948935 CCCACATGGCAGAAGGTGGAAGG - Intronic
1006834536 6:36989470-36989492 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1007702813 6:43774354-43774376 CACCCATGGCAGAAGGAGGAGGG + Exonic
1007793803 6:44330869-44330891 CAATCATGGCAGAAGGTGGAAGG - Intronic
1009052431 6:58292514-58292536 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1009238679 6:61158100-61158122 CAGTCATGGCAGAAGGTGGAGGG - Intergenic
1009344872 6:62600948-62600970 CCCTCATGGCAGAAGGTGAAGGG - Intergenic
1010891640 6:81319878-81319900 CCTCACTGGAAGAAAGTAGAAGG - Intergenic
1011334927 6:86249971-86249993 CAGTTATGGCAGAAGGTGGAGGG - Intergenic
1011602762 6:89075246-89075268 CCTCAGTGGTATAAGGAGGAGGG + Intergenic
1011996319 6:93593421-93593443 CGTCTATAGCAGAAGGTGGAAGG - Intergenic
1012349759 6:98235744-98235766 CTTTCATGGCAGAAGGTGAAGGG + Intergenic
1013156253 6:107492997-107493019 TCTCAAAGTCAAAAGGTGGAAGG + Intronic
1013688307 6:112610754-112610776 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1014482955 6:121961299-121961321 ATCCTATGGCAGAAGGTGGAAGG - Intergenic
1014749525 6:125239402-125239424 CAATTATGGCAGAAGGTGGAAGG + Intronic
1015680265 6:135799657-135799679 CATTAATGGCAGAAGGTGAAGGG - Intergenic
1015977028 6:138800969-138800991 CTCACATGGCAGAAGGTGGAAGG + Intronic
1016224885 6:141722969-141722991 CAACCATGGCAGAAGGTGAAGGG - Intergenic
1016526741 6:145010195-145010217 CCTACATGGTGGAAGGTGGAAGG - Intergenic
1016790017 6:148058626-148058648 ACTGAATGGCAAAAGCTGGAAGG - Intergenic
1017219555 6:151950123-151950145 CAATCATGGCAGAAGGTGGAAGG - Intronic
1017561157 6:155629369-155629391 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1018116544 6:160591381-160591403 CATATTTGGCAGAAGGTGGAAGG - Intronic
1018547353 6:164952345-164952367 CAGAAGTGGCAGAAGGTGGAAGG - Intergenic
1018593640 6:165454609-165454631 ATCCCATGGCAGAAGGTGGAAGG - Intronic
1018900258 6:168048364-168048386 CTTCAAGGTCAGAAGGAGGACGG - Intergenic
1018974091 6:168551189-168551211 CCATCATGGCAGAAGGTGAAGGG - Intronic
1021023637 7:15636838-15636860 CCTTAATGGCAAAAGGCAGAAGG + Intronic
1021385809 7:20028345-20028367 AATCAATGGCAGAAGGTGAAGGG - Intergenic
1021795932 7:24254293-24254315 TCTCCATGGGAGAAGGGGGAAGG - Intergenic
1023123789 7:36935263-36935285 CCATCATGGCAGAAGGTGAAAGG - Intronic
1023213165 7:37830295-37830317 CTGCAATGGCAGAGGGTAGAAGG + Intronic
1024490692 7:49980556-49980578 CACCCATGGCAGAAGGTGAAAGG + Intronic
1024509230 7:50190112-50190134 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1025285530 7:57657543-57657565 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1026691604 7:72554641-72554663 CATCCATGGCTGAAGGTAGAAGG + Intergenic
1027141686 7:75662061-75662083 CCACAAGGGGTGAAGGTGGAGGG + Intronic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1029413280 7:100428694-100428716 CCTCATTGGCAGAAGCTGGGGGG + Intronic
1029952584 7:104602832-104602854 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031443881 7:121827066-121827088 CATCCATGGCAGAAGGTGAGAGG - Intergenic
1032914420 7:136473268-136473290 CAATAATGGCAGAAGGTGAAAGG - Intergenic
1033440169 7:141371369-141371391 CCACTATGGCAGAAGGTGAAGGG - Intronic
1033616821 7:143024322-143024344 ATCCTATGGCAGAAGGTGGAAGG - Intergenic
1033841289 7:145377480-145377502 CAATGATGGCAGAAGGTGGAGGG + Intergenic
1033975654 7:147097458-147097480 CCATCATGGCGGAAGGTGGAGGG + Intronic
1034206502 7:149320489-149320511 CAACAATGGCCGAAGGTGAAGGG + Intergenic
1034783154 7:153900474-153900496 CACTCATGGCAGAAGGTGGAGGG + Intronic
1034982896 7:155489933-155489955 CTTCTCTGGCAGCAGGTGGAAGG + Intronic
1035455984 7:159009071-159009093 CCTTAATGGTGGAAGATGGAGGG + Intergenic
1036057915 8:5280376-5280398 CCTGAATGTCAGAGGGAGGAGGG - Intergenic
1036594954 8:10203173-10203195 CATGAATTGGAGAAGGTGGAGGG - Intronic
1038090987 8:24252762-24252784 TCCCCATGGCAGAAGGTGGAAGG + Intergenic
1038922463 8:32099907-32099929 ACTCAGTGGATGAAGGTGGAGGG + Intronic
1038922927 8:32105353-32105375 CAATCATGGCAGAAGGTGGAAGG + Intronic
1038936664 8:32259440-32259462 ATCCCATGGCAGAAGGTGGAAGG - Intronic
1041151953 8:54944242-54944264 CTCCAGTGGCAGAAGGTGGAGGG + Intergenic
1041223162 8:55671690-55671712 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1041815171 8:61962299-61962321 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1042405199 8:68396806-68396828 CCCTCATGGCAGAAGGTGAAGGG - Intronic
1042427432 8:68664340-68664362 CCTAAATGGCATAAGGAGTAAGG + Intronic
1042501776 8:69516295-69516317 GCAGAATGGCAGAAGGTGAAGGG + Intronic
1042851142 8:73217165-73217187 CCCACATGGCTGAAGGTGGAAGG - Intergenic
1043030591 8:75129620-75129642 CAAGAATGGCAGAAGGTGAAGGG - Intergenic
1043265879 8:78267037-78267059 CCTCAATTTCAGAAGATGTATGG + Intergenic
1043655547 8:82661124-82661146 TCTCGAAGGCAGAAGATGGATGG + Intergenic
1043697573 8:83240072-83240094 ATCCAATGGCAGAAGGTGTAAGG + Intergenic
1043714697 8:83467270-83467292 CCTCAATTTCAGAGGGTGTATGG + Intergenic
1044310628 8:90687933-90687955 TGACAATGGCAGAAGGTGAAGGG + Intronic
1044737821 8:95297235-95297257 CAACCATGGCAGAAGGAGGAAGG + Intergenic
1044895268 8:96885176-96885198 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1044913419 8:97086443-97086465 CCTAAATGGTACAAGGTGCAGGG + Intronic
1045998776 8:108395218-108395240 CTTACATGGCAGAAGGTGAAGGG + Intronic
1046300019 8:112275615-112275637 CAATCATGGCAGAAGGTGGAAGG + Intronic
1046334702 8:112770326-112770348 CTCATATGGCAGAAGGTGGAAGG - Intronic
1047206564 8:122806993-122807015 GCTCACTGGTAGAGGGTGGAGGG + Intronic
1047425558 8:124742392-124742414 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1047990065 8:130276921-130276943 ACTCAATGGCAGACGATGGAAGG + Intronic
1048443400 8:134476392-134476414 CCTCAAGGGCATAAGGTAGTGGG - Intergenic
1049406229 8:142452867-142452889 CCGCAGTGGCGGAAGGCGGAGGG + Intronic
1049648154 8:143746252-143746274 CCTCAATGGTAAAAGGCTGAAGG - Intergenic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1051375731 9:16400539-16400561 CCCCCATGGCTGAAGGTGGAAGG + Intergenic
1053034385 9:34811490-34811512 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1053390308 9:37730180-37730202 GCTCAAAGGCAGCAGGTGCAAGG - Intronic
1055402830 9:75942588-75942610 GCACGGTGGCAGAAGGTGGAGGG + Intronic
1055832752 9:80401531-80401553 CCTGAATGGCAGTTGGTTGAAGG - Intergenic
1056423335 9:86451786-86451808 CTCAAATGGCAGAAGGTAGAAGG + Intergenic
1056661877 9:88549750-88549772 CAACCATGGCAGAAGGTGAAAGG + Intronic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG + Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1057949059 9:99355498-99355520 CCTCAATGGCAGAAGATACTTGG - Intergenic
1058293897 9:103280498-103280520 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1059689412 9:116670345-116670367 CCACAAGGGCAGGAGGTAGAAGG + Intronic
1059825686 9:118026263-118026285 ATTCCATGGCAGAAGGTAGATGG + Intergenic
1059958819 9:119545374-119545396 CCTCAATGCCAGGAGGATGATGG - Intergenic
1060011600 9:120048329-120048351 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1060746433 9:126136341-126136363 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1061379738 9:130247281-130247303 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1185977571 X:4738633-4738655 CCTCTTTGGGAGCAGGTGGAAGG + Intergenic
1186541167 X:10402012-10402034 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1187550000 X:20293045-20293067 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1188520502 X:31033050-31033072 CAATAATGGCAGAAGGTGAAAGG + Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1190973136 X:55371985-55372007 CTTATATGGCAGAAGGAGGAAGG + Intergenic
1192230386 X:69260592-69260614 CCTCAGTAGCAGAAGGGGCAAGG + Intergenic
1192279345 X:69667841-69667863 ACTCCATGGCAGAAGGTGGAAGG + Intronic
1192343271 X:70281300-70281322 CAACAAGAGCAGAAGGTGGAGGG - Intronic
1193307611 X:79968051-79968073 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1193498697 X:82244736-82244758 CTATAATGGCAGAAGGTGAAAGG + Intergenic
1193667422 X:84338930-84338952 CAATAATGGCAGAAGGTGAAAGG - Intronic
1193843829 X:86443607-86443629 ACTCAATGGCAAAAAGTTGAAGG - Intronic
1193886466 X:86988049-86988071 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1194172947 X:90611236-90611258 CATTCATGGCAGAAGGTGAAGGG + Intergenic
1194618485 X:96137545-96137567 CAACCATGGCAGAAGGTGAAGGG - Intergenic
1195168018 X:102239359-102239381 ATCCAATGGCAGAAGGTGGGAGG + Intergenic
1195190839 X:102447728-102447750 ATCCAATGGCAGAAGGTGGGAGG - Intronic
1195265920 X:103179643-103179665 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1197367159 X:125578406-125578428 CTTCCATGGCAGAAGGTGGGAGG + Intergenic
1197673430 X:129303661-129303683 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1197982513 X:132231709-132231731 CGATAATGGCAGAAGGTGAAGGG + Intergenic
1198742747 X:139858089-139858111 GCCCCATGGCAGAAGGTGGAAGG - Intronic
1199137546 X:144270889-144270911 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1199203076 X:145116189-145116211 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1199549173 X:149039932-149039954 ACTCCATGGCAGAAGGCAGAAGG + Intergenic
1199569226 X:149251424-149251446 CAACCATGGCAGAAGGTGAAAGG + Intergenic
1199584121 X:149395208-149395230 ACTATATGGCAGAAGGTGAAGGG - Intergenic
1202045817 Y:20736564-20736586 CAACAATGACAGAAGGTGAAAGG + Intergenic