ID: 968028859

View in Genome Browser
Species Human (GRCh38)
Location 3:195465799-195465821
Sequence AAATGAGTTCTGCAACATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968028857_968028859 -6 Left 968028857 3:195465782-195465804 CCAAGGGGACCTGGAGCAAATGA No data
Right 968028859 3:195465799-195465821 AAATGAGTTCTGCAACATACTGG No data
968028851_968028859 27 Left 968028851 3:195465749-195465771 CCAGGAATGGCCGTGTGGCTGGA No data
Right 968028859 3:195465799-195465821 AAATGAGTTCTGCAACATACTGG No data
968028852_968028859 17 Left 968028852 3:195465759-195465781 CCGTGTGGCTGGAGCAGAGTAAG No data
Right 968028859 3:195465799-195465821 AAATGAGTTCTGCAACATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968028859 Original CRISPR AAATGAGTTCTGCAACATAC TGG Intergenic
No off target data available for this crispr