ID: 968034010

View in Genome Browser
Species Human (GRCh38)
Location 3:195530007-195530029
Sequence GTATATGTGAAAATAGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968034010_968034014 4 Left 968034010 3:195530007-195530029 CCAACCTCTATTTTCACATATAC 0: 1
1: 0
2: 2
3: 21
4: 311
Right 968034014 3:195530034-195530056 TTGGAATAGAAGCTGACTCAGGG 0: 1
1: 0
2: 1
3: 37
4: 256
968034010_968034013 3 Left 968034010 3:195530007-195530029 CCAACCTCTATTTTCACATATAC 0: 1
1: 0
2: 2
3: 21
4: 311
Right 968034013 3:195530033-195530055 CTTGGAATAGAAGCTGACTCAGG 0: 1
1: 0
2: 0
3: 28
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968034010 Original CRISPR GTATATGTGAAAATAGAGGT TGG (reversed) Intronic
900874544 1:5332052-5332074 GTATTTCTGAAAGTACAGGTGGG - Intergenic
901507850 1:9697326-9697348 ATATATGTGGAAGTGGAGGTCGG + Intronic
903268100 1:22170593-22170615 GTATTTTTTAAAATAGAGATGGG - Intergenic
903811291 1:26036342-26036364 GTATAGGTGAGAATGGAGTTGGG + Exonic
909383171 1:75024686-75024708 CTAGATGTGAAAATAGAAGTAGG - Intergenic
909618342 1:77638250-77638272 GGATATGTGAAATTATAGGTAGG - Intronic
909922011 1:81393620-81393642 GCATATGTGAATCAAGAGGTAGG + Intronic
910224000 1:84917840-84917862 GTATATGAGAAAATATGTGTAGG + Intergenic
910465011 1:87489824-87489846 GCATATGAGTAAACAGAGGTAGG - Intergenic
910722071 1:90297145-90297167 GTAGAAGTGCCAATAGAGGTAGG - Intergenic
911742711 1:101404543-101404565 GTATTTTTGAAAAGAGTGGTGGG - Intergenic
911904685 1:103551970-103551992 TTATATGTGAAAATTAAGTTTGG + Intronic
912234854 1:107838900-107838922 GTATATGTGGACATAAAGATGGG + Intronic
912425653 1:109587546-109587568 ATATATGAGAATATGGAGGTAGG + Intronic
912724369 1:112045522-112045544 GTAAAATGGAAAATAGAGGTGGG - Intergenic
912873726 1:113333406-113333428 CTATATGTAAAAAAACAGGTTGG - Intergenic
915244210 1:154544701-154544723 GTGGATGTGAAAGTGGAGGTAGG - Intronic
915731925 1:158059978-158060000 TTATATGTAAACATACAGGTTGG + Intronic
915793056 1:158695967-158695989 GGATATGTAAAAATAGTGGAAGG + Intergenic
915811286 1:158914688-158914710 GTATAGGTGAATATAGCTGTGGG + Intergenic
917384988 1:174462721-174462743 GTACATGTGAATATAAAGATTGG - Intronic
918435779 1:184511402-184511424 TACTATGTGAAAATAGAGGTTGG + Intronic
919527398 1:198670978-198671000 GTATATGGGAAAATATACTTAGG + Intronic
920391104 1:205602401-205602423 TTACATGTGAAAAGTGAGGTTGG - Exonic
921748012 1:218759661-218759683 GAGTAAGTGAAAATAGAGGTGGG + Intergenic
922053579 1:222018700-222018722 GAATCTGTGAAAATATAGTTGGG - Intergenic
922676551 1:227556325-227556347 GTATATGATAACATATAGGTAGG - Intergenic
922982615 1:229840603-229840625 GTACATGTGGAAATAGAGTATGG + Intergenic
923711729 1:236393079-236393101 GTTTATGTGAAAATACTGGCTGG - Intronic
924407856 1:243770526-243770548 GTATATGAGAAGACAGAGATAGG + Intronic
924663312 1:246043065-246043087 ATTTATGTGTAGATAGAGGTGGG - Intronic
1063230151 10:4058307-4058329 GTATATTTAAAAATAAAAGTTGG - Intergenic
1064941060 10:20736009-20736031 ATATATGTGAATATAGATGGTGG - Intergenic
1065084020 10:22156227-22156249 GTATATGGGAGAAGATAGGTAGG - Intergenic
1066635391 10:37494497-37494519 GTATTTCTGAAAATGGAGGAAGG - Intergenic
1067754002 10:48990889-48990911 GTATATGTATACATATAGGTAGG - Intergenic
1067950531 10:50732799-50732821 GTATATGTCAAAATAGCTGAAGG - Intergenic
1068193769 10:53688960-53688982 GTATATGAGAAAATATGAGTAGG - Intergenic
1068231608 10:54174564-54174586 GTATATGAGAAAAAATTGGTAGG + Intronic
1068875158 10:61987902-61987924 TTTTATGAGAAAAGAGAGGTAGG + Intronic
1069294030 10:66821437-66821459 GTTGATGTGAAAAAAGTGGTAGG + Intronic
1069460252 10:68588170-68588192 TTATATGTAGAAATAGAGATGGG + Intronic
1069489094 10:68846032-68846054 TTAAATCTCAAAATAGAGGTGGG - Intronic
1071016941 10:81008536-81008558 GTAGAGGTGGAAATAGAGATAGG + Intergenic
1071045423 10:81369225-81369247 TAATAAGTGAAAATAGATGTAGG - Intergenic
1071109999 10:82144617-82144639 GTTTATGTGAAAAGAGATCTGGG + Intronic
1072085890 10:92078814-92078836 GTAGCTGTGAGAATAGCGGTAGG + Intronic
1074306528 10:112284250-112284272 GTATCTGTGAAACCACAGGTAGG - Intronic
1074572661 10:114638508-114638530 TTATATGTGAGAAAAGAGGTTGG + Intronic
1077584963 11:3444137-3444159 GTGTTTGTGCAAAAAGAGGTTGG - Intergenic
1077677822 11:4212734-4212756 GTATTTTTAAAAATAGAGTTGGG + Intergenic
1077866698 11:6228174-6228196 GTATTTTTTAAAATAGAGATGGG - Intronic
1079356171 11:19731870-19731892 GTATGTGTGAAGTCAGAGGTAGG + Intronic
1079621646 11:22562775-22562797 GTACATGTGAACATAAAGATGGG - Intergenic
1080509563 11:32954689-32954711 GTATTTTTTAAAATAGAGATGGG + Intronic
1082277918 11:50241622-50241644 TTATATGTAGAAATAGAGATGGG + Intergenic
1083982723 11:66186506-66186528 GATTGTGTGAAAATAGAGCTAGG - Intronic
1084830476 11:71765148-71765170 GTGTTTGTGCAAAAAGAGGTTGG + Intergenic
1085742840 11:79091782-79091804 GTATATTTGAAAAAAGAGGGTGG - Intronic
1085936572 11:81152933-81152955 GTCAGTTTGAAAATAGAGGTTGG + Intergenic
1086063783 11:82726285-82726307 GTAAATGAGAAAAGAGAGGCCGG + Intergenic
1086876628 11:92104297-92104319 ATACATGTGAAAGGAGAGGTTGG + Intergenic
1087453982 11:98360075-98360097 GTGTATGTGAAAACAGAGAGAGG + Intergenic
1090128038 11:124109972-124109994 GTAGATATCAAAATACAGGTGGG - Intergenic
1091067392 11:132528760-132528782 GAATTTCTGAAAGTAGAGGTGGG - Intronic
1091248042 11:134116676-134116698 GTATATGGGAAACTAGACCTGGG + Intronic
1091464118 12:669039-669061 GTAAATGTGAACTTAGAGGCTGG - Intergenic
1092412108 12:8261399-8261421 GTGTTTGTGCAAAAAGAGGTTGG - Intergenic
1092899178 12:13042801-13042823 GCAGATGAGAAAATTGAGGTGGG + Intergenic
1093859832 12:24151116-24151138 GTAAATGTCAAAATAGATGAAGG + Intergenic
1095837790 12:46657052-46657074 ATATTTGTGAAAATAGAGGTGGG + Intergenic
1097655608 12:62358836-62358858 GTATATGTGAAGATATATGTAGG + Intronic
1098045701 12:66398172-66398194 GCATTGGTGAAAATAGAAGTGGG - Intronic
1098054843 12:66493986-66494008 GTATATGTAAAAAAAGAGGCAGG + Intronic
1098942656 12:76555834-76555856 GGAGAGGTGAAAATAGAGATGGG + Intronic
1099016596 12:77350734-77350756 GTATATGGGAAAATAGTGAGGGG + Intergenic
1099201301 12:79680553-79680575 GCATATGTGAAAATGGAGTTTGG - Intronic
1099952138 12:89315555-89315577 GTTTATGAGGAAAAAGAGGTGGG + Intergenic
1100073240 12:90747239-90747261 ATCTTTGTGAAAATAGAGTTTGG + Intergenic
1100105210 12:91162574-91162596 GTAGATATGAAATTAGAGTTTGG + Intronic
1101923060 12:108948429-108948451 GTAGATATGAAAATGGTGGTAGG - Intronic
1102576370 12:113858557-113858579 GCATATGTGAAACTAGGGGAGGG + Intronic
1102638663 12:114346843-114346865 CTATGTCTGAAATTAGAGGTGGG + Intergenic
1103861203 12:124015805-124015827 CTGTGTGTGAAAATCGAGGTTGG - Intronic
1104585013 12:130041514-130041536 ATATATGTGTATATAGATGTAGG + Intergenic
1104606330 12:130192104-130192126 GCATATGTGTATATGGAGGTTGG + Intergenic
1105574782 13:21640239-21640261 GTAAACGTGAAATCAGAGGTTGG - Intergenic
1108218995 13:48214544-48214566 ATATATGTGACAATACAGATAGG - Intergenic
1110206463 13:72920096-72920118 GAATTTTTAAAAATAGAGGTTGG + Intronic
1110298035 13:73892836-73892858 ATATTTGTGGGAATAGAGGTGGG + Intronic
1110485933 13:76042063-76042085 GTATATGTGAGCATACATGTGGG + Intergenic
1111422510 13:88032873-88032895 ATATGTGTGGAAATAGGGGTTGG + Intergenic
1112362229 13:98728682-98728704 GTATATTTCAAAATAGAGGCTGG + Intronic
1113316632 13:109187109-109187131 GAATATGTGAAAATACTGCTTGG - Intronic
1113536192 13:111067816-111067838 GAAAATGTAAAAAAAGAGGTTGG - Intergenic
1114564597 14:23620925-23620947 ATACATGTCAAAATAGAAGTAGG - Intergenic
1115962622 14:38852699-38852721 GCATATATGAGGATAGAGGTTGG + Intergenic
1118083662 14:62390823-62390845 ATACATGTGGAAATAAAGGTAGG + Intergenic
1118462310 14:65998353-65998375 GTAGATGTGAAAATGGAGACTGG + Intronic
1119297713 14:73546788-73546810 ATTTATTTGAAAACAGAGGTTGG + Intronic
1121392716 14:93589814-93589836 GCATGTCGGAAAATAGAGGTGGG + Intronic
1121992637 14:98574535-98574557 GTGTGTGTGAAAATTGAGCTTGG - Intergenic
1122582516 14:102779793-102779815 GAAGATGAGAAAATAGAGTTGGG - Intronic
1124173240 15:27396904-27396926 TTATAGGAGAAAAAAGAGGTTGG + Intronic
1124501727 15:30233835-30233857 GTATATGTGAGCATAAAGATGGG - Intergenic
1124741838 15:32304816-32304838 GTATATGTGAGCATAAAGATGGG + Intergenic
1124901527 15:33827449-33827471 GTATATTTGAAGACAGAAGTGGG + Intronic
1125804042 15:42477440-42477462 TAATATGGGAAACTAGAGGTGGG - Intronic
1126273733 15:46850958-46850980 GCATATGTGGAAGTACAGGTGGG + Intergenic
1127229292 15:56971120-56971142 GAATCTTTGAAAATAGAGGGTGG + Intronic
1128002589 15:64207286-64207308 GTTTATGTTTAAATAGAGATGGG + Intronic
1128055589 15:64697475-64697497 GTATATGGGAAGATATATGTAGG + Intronic
1128368377 15:67021237-67021259 GTACATGTGAAAAGTAAGGTAGG - Intergenic
1128672499 15:69585130-69585152 GTTTATGATAAGATAGAGGTTGG + Intergenic
1130819054 15:87473472-87473494 GTACATGTGGACATAGAGGTTGG + Intergenic
1131923369 15:97354527-97354549 GCATATGTCAAAAAAGAGGGAGG - Intergenic
1133458584 16:5966073-5966095 GTACATCTGAAAAAAGAGTTAGG - Intergenic
1137955667 16:52826405-52826427 GTATCTTTGAAAATGGATGTAGG - Intergenic
1138698363 16:58837047-58837069 GTATATGTGAAAACACAGTATGG + Intergenic
1139011463 16:62639774-62639796 GTATATGTAAAAACATAGGCAGG - Intergenic
1139546121 16:67650427-67650449 GTATATGTGAGGACAGAGATGGG - Intronic
1140610722 16:76595837-76595859 GCACATTTGAAAATAAAGGTGGG - Intronic
1146291210 17:31608630-31608652 TTATATGTTAAACAAGAGGTAGG + Intergenic
1148445975 17:47737428-47737450 GTGCATGTGAAGACAGAGGTTGG + Intronic
1149373194 17:56017179-56017201 GAATTTGTGAAAGAAGAGGTCGG - Intergenic
1149613992 17:57982597-57982619 GTTTATGTGAGAACAGATGTGGG - Intronic
1149737369 17:59008795-59008817 GCATATGTGGAACTAGAGGCAGG - Intronic
1153126101 18:1792700-1792722 GTAATTGAGAAAATAGAGATAGG + Intergenic
1154930803 18:20993625-20993647 TTTTCTGTGAAAATAGAGTTTGG - Intronic
1156229014 18:35136075-35136097 GAAGATGTGAAAATCCAGGTGGG + Intronic
1157552163 18:48589366-48589388 GTACATGTGAAGATGGAGGCAGG - Intronic
1157574420 18:48733991-48734013 GGATATTTGAAAATAAAGCTGGG + Intronic
1158060160 18:53330735-53330757 ATATATGTGAAAATACACTTGGG - Intronic
1158089247 18:53691377-53691399 GTAGATGTGAAAAAACAGCTTGG - Intergenic
1159128168 18:64249076-64249098 GTTTATGTAAAAATAAATGTTGG + Intergenic
1162006264 19:7781834-7781856 GTATATTTGGAAAAAGGGGTCGG - Intergenic
1163341217 19:16708405-16708427 GTATTTTTTAAAATAGAGATGGG - Intergenic
1165641011 19:37386670-37386692 CTATATGTAAAGATAGTGGTTGG + Intronic
1165909305 19:39214876-39214898 GTATTTTTTAAAATAGAGATGGG + Intergenic
1167892178 19:52549275-52549297 GTGTTTGTGAAAACAGAGCTAGG - Intronic
1167893355 19:52560399-52560421 GTGTCTGTGAAAACAGAGGCAGG - Intronic
1168646157 19:58060269-58060291 CTAGATGTGCAAATAGAGGCCGG - Intronic
925416735 2:3675503-3675525 TTATCTGTGAAGAGAGAGGTGGG + Intronic
926318749 2:11732971-11732993 ATATATGTGGAAATATTGGTCGG - Intronic
927616947 2:24607908-24607930 GTAAATAAGAAAATACAGGTAGG - Intronic
928755537 2:34521044-34521066 CTAAATTTGAAAATATAGGTAGG + Intergenic
930367611 2:50460475-50460497 CTATATGAGAAAATTTAGGTGGG - Intronic
930421546 2:51159437-51159459 GAATATATGGAAATAGGGGTTGG + Intergenic
931164328 2:59730197-59730219 GTATCTGAGAAAACATAGGTTGG + Intergenic
931788380 2:65641938-65641960 CTATATGTGTATATAAAGGTAGG - Intergenic
932982587 2:76687634-76687656 ATATATGAGAAAACTGAGGTAGG + Intergenic
935126679 2:100230651-100230673 GGATATGTGAAATAAGAGATAGG - Intergenic
935140156 2:100345765-100345787 ATATAGGTTAAAAAAGAGGTTGG + Intergenic
940304274 2:152208733-152208755 TTATTTGGGAAAACAGAGGTAGG + Intergenic
940975403 2:159937996-159938018 GCATTTGTGTAAAGAGAGGTGGG + Exonic
941139107 2:161755550-161755572 GTATGTGAGAAAAGAGAGGGTGG - Intronic
941300874 2:163799576-163799598 GTATATGAAAAAATAGATTTTGG - Intergenic
941413067 2:165184728-165184750 ATACATGTGAAAGTAGACGTGGG - Intronic
941472036 2:165900039-165900061 GTGTAAGAGAAAATAGAGATGGG - Intronic
941630725 2:167881294-167881316 ATATATGAGAAAATATGGGTTGG - Intergenic
941785040 2:169488995-169489017 ATTTATGTTTAAATAGAGGTAGG + Intronic
943619471 2:190131855-190131877 GTGACTGTGAAAGTAGAGGTAGG + Intronic
943888748 2:193257698-193257720 GTATATGTGAAAATGATGCTTGG - Intergenic
944359496 2:198836283-198836305 GTATTTGTGAAAATGTAGGTTGG + Intergenic
945150483 2:206785298-206785320 GGATATTTGGAAATAGAGGAAGG + Intronic
946657160 2:221960851-221960873 GGAGATGTGAAAATAGAAGCTGG - Intergenic
946667774 2:222068699-222068721 TTAAATGAGATAATAGAGGTAGG - Intergenic
947114968 2:226760001-226760023 GTACTTCTAAAAATAGAGGTGGG - Intronic
1173022362 20:39277552-39277574 GTATAGGTCAAAATCCAGGTGGG - Intergenic
1173631984 20:44523299-44523321 GGATCTGGGAAAAGAGAGGTAGG - Intergenic
1173849474 20:46208887-46208909 TGATATGTAAAAATAGAGGCCGG - Intronic
1177551556 21:22629141-22629163 GTATATAACAAAATTGAGGTGGG + Intergenic
1178115526 21:29412617-29412639 GTTTATATGAACATAGAGGCTGG - Intronic
1178340190 21:31779336-31779358 GCAGATGTGTATATAGAGGTAGG + Intergenic
1178670554 21:34587609-34587631 ATATATGTTAAAATACATGTAGG + Intronic
1179096306 21:38318789-38318811 GTATATAAGAGAATAGATGTAGG - Intergenic
1179717155 21:43295001-43295023 TTATAGGAGAAAATATAGGTGGG - Intergenic
1181007161 22:20019320-20019342 GTTTGTGTGCAATTAGAGGTTGG + Intronic
1181677342 22:24464239-24464261 GTATAATTTACAATAGAGGTTGG - Intergenic
1182645875 22:31808937-31808959 ATATATATAAAAATAGAGATGGG + Intronic
1183278722 22:36920060-36920082 GTAGATGAGAAAACAGGGGTGGG - Intronic
950107858 3:10399670-10399692 GTAGGAGTGAGAATAGAGGTGGG - Intronic
950594974 3:13971937-13971959 GTATATGTAAAAAGAGATGAAGG - Intronic
952052421 3:29400682-29400704 GAATAGGTGAAAATGGAAGTTGG + Intronic
952205558 3:31178621-31178643 GTAAATGAGGAAATAGAAGTAGG - Intergenic
952802897 3:37313708-37313730 GTATATGTGTACATATATGTGGG - Intronic
952856583 3:37776173-37776195 GTCTATTTGAGAATGGAGGTTGG + Intronic
953458745 3:43064421-43064443 GGCAATGTGAAAACAGAGGTAGG - Intergenic
955268334 3:57469783-57469805 GTATACATGAACATAGAGATGGG + Intronic
957479116 3:80769049-80769071 TTATATTTGAAATTAGAGATTGG + Intergenic
957581874 3:82084565-82084587 GTATCTGGGAACATAGAGGCAGG + Intergenic
959213790 3:103423808-103423830 CTACAAGTGAAAAAAGAGGTGGG - Intergenic
959608483 3:108267875-108267897 GTATTTGTGAGACAAGAGGTTGG - Intergenic
959643299 3:108666162-108666184 GTATATTTGAAAAGTGAGGAGGG + Intronic
959645598 3:108696631-108696653 GGCCATGTGAAAATAGAAGTTGG - Intergenic
963099978 3:141591849-141591871 CTGTATGTGAAAATACAGGTAGG - Intronic
963559497 3:146844736-146844758 ATATATGTGAACACAAAGGTTGG + Intergenic
963688139 3:148463783-148463805 GTATATTTATAAATAGGGGTAGG - Intergenic
964217856 3:154308022-154308044 GTATATGTGGACATAGAGTGTGG + Intronic
964230140 3:154456443-154456465 GTATATCTGAAAATACAAATTGG - Intergenic
964305076 3:155330988-155331010 GTATATTTGAAAATAAACATGGG + Intergenic
964363249 3:155920943-155920965 GTATTTGGTAAAATAGAGGTTGG + Intronic
965471605 3:169100017-169100039 GAAAATATGAAACTAGAGGTAGG - Intronic
967744709 3:193042446-193042468 ATAAATGTGAGAATGGAGGTGGG - Intergenic
968034010 3:195530007-195530029 GTATATGTGAAAATAGAGGTTGG - Intronic
968189299 3:196655786-196655808 CTAGATGTGAAAATAGACTTGGG + Intronic
968274962 3:197433916-197433938 CCGTATGTGAAAATGGAGGTGGG - Intergenic
969000157 4:3973980-3974002 GTGTTTGTGCAAAAAGAGGTTGG - Intergenic
969667986 4:8573197-8573219 GAAAATGTGAAGAAAGAGGTTGG - Intronic
969813753 4:9670823-9670845 GTGTTTGTGCAAAAAGAGGTTGG + Intergenic
970120124 4:12744245-12744267 GTGGATGTGAAGAAAGAGGTGGG + Intergenic
970782324 4:19752862-19752884 CTACATGTGCAAATATAGGTGGG + Intergenic
970830147 4:20328601-20328623 TTATATTTGAAAATTGAGTTTGG + Intronic
972497006 4:39643462-39643484 TCATATTTGAAAATAGAGCTAGG + Intergenic
973185373 4:47321350-47321372 GTATATATGGAAATAGATGAAGG + Intronic
973226996 4:47797278-47797300 GTATATGTAAAATTTGAGGAAGG + Intronic
973925670 4:55735159-55735181 GTATATATGAACATAAAGATAGG + Intergenic
974032683 4:56789925-56789947 GTTTATGTGAAAATAGGATTGGG - Intergenic
974210779 4:58772318-58772340 GAATATGAGATCATAGAGGTCGG - Intergenic
975446110 4:74467527-74467549 GCAAATGAGAAAATTGAGGTTGG - Intergenic
975722925 4:77265687-77265709 GGAAATGTGAAAATAGGGATTGG + Intronic
975931291 4:79526358-79526380 GCATATGTGAAAATAGTGGCAGG - Intergenic
976155422 4:82139162-82139184 CTATTTTTTAAAATAGAGGTGGG - Intergenic
976200728 4:82575775-82575797 GTATTTGTGAAAATTGATGAAGG - Intergenic
976474033 4:85462082-85462104 CTATATGTGAAAATATTGTTAGG + Intergenic
977031989 4:91894752-91894774 GAAAATGTGAAAAGAGAGATTGG + Intergenic
979092678 4:116505344-116505366 GTAAGTGTGAAAGTAGAGGCAGG + Intergenic
979979009 4:127231566-127231588 GTAAATGTGAAAATTGACTTAGG - Intergenic
980652405 4:135735615-135735637 GTATATTTTAAAATATAGGGGGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981328963 4:143485626-143485648 ATCTATGTGAGAAAAGAGGTAGG - Intergenic
982231528 4:153212339-153212361 GTATATGTGGACATAGAGAGTGG + Intronic
982655754 4:158147921-158147943 AAATATTTGAAAATAGAGGCTGG + Intronic
982963466 4:161871540-161871562 TTATATGTGATAATATATGTAGG - Intronic
983184587 4:164687507-164687529 GTGTATGAGAAAATATAGGATGG - Intergenic
983191831 4:164762346-164762368 GTATTTGTTAAAATAGAAGAAGG - Intergenic
984578872 4:181486698-181486720 GCACCTCTGAAAATAGAGGTTGG - Intergenic
987955599 5:24735675-24735697 GTATATTTGGAAGAAGAGGTCGG - Intergenic
989040523 5:37223102-37223124 GTATATGTGATATTGGCGGTAGG - Intronic
991733516 5:69611141-69611163 GTATATGTGATAATAAAGTGTGG + Intergenic
991809950 5:70466287-70466309 GTATATGTGATAATAAAGTGTGG + Intergenic
991861438 5:71016709-71016731 GTATATGTGATAATAAAGTGTGG - Intronic
994266957 5:97728662-97728684 GGAGAGGTGAAAATAAAGGTGGG - Intergenic
996870530 5:128187249-128187271 GTATATGTGAATATAGAGCTAGG + Exonic
1000471145 5:161643639-161643661 GTAAATGTAAAAATAGAAATAGG - Intronic
1001011055 5:168098827-168098849 GTATATGTCTAAATACAAGTAGG + Intronic
1001458443 5:171886707-171886729 GTATATATAAAAATAGAGTTCGG + Intronic
1003409002 6:5846913-5846935 GTGAATGTGAAAACTGAGGTGGG - Intergenic
1004153780 6:13148570-13148592 GTATATGTGAAAAAAAAGGAAGG - Intronic
1007583802 6:42976174-42976196 GTATTTTTTAAAATAGAGATGGG + Intronic
1010699006 6:79018439-79018461 GTAAAACTGAAAATAAAGGTAGG + Intronic
1011903106 6:92325616-92325638 CTATTTATAAAAATAGAGGTTGG - Intergenic
1012289343 6:97433571-97433593 GGATATGAGAAAATAGAAGCAGG - Intergenic
1012468377 6:99540874-99540896 GTAAATGTAAAAATATATGTTGG - Intergenic
1012473230 6:99593779-99593801 GTATAACTGAAAATATAGGGAGG - Intergenic
1013698565 6:112733811-112733833 GTATATGTGAAAATATCAGTGGG + Intergenic
1013944048 6:115701817-115701839 GTATATGTGGATATAGAGGGTGG - Intergenic
1013969451 6:115999385-115999407 GTAGATCTGAAAAGAGAGTTAGG - Intronic
1014306267 6:119746673-119746695 GTACATGTGAACATAAAGATGGG - Intergenic
1014365832 6:120540550-120540572 GTATGTATGAGAGTAGAGGTGGG + Intergenic
1015474569 6:133645964-133645986 GAATATGTGTAAATAGCGGAAGG + Intergenic
1016270779 6:142288015-142288037 GTCTGTGTGAGAATAGAGGGAGG + Intergenic
1016426427 6:143940889-143940911 GTATATGTAAAACTACAGGTTGG + Exonic
1017332910 6:153220692-153220714 GTATTTTTGAAAATATAGTTTGG - Intergenic
1018338233 6:162819175-162819197 GTATATGTGAGAATGGACTTAGG + Intronic
1018373567 6:163190384-163190406 TTGAAAGTGAAAATAGAGGTCGG + Intronic
1020499664 7:8901502-8901524 ATATATGGGAAAACACAGGTAGG - Intergenic
1020798842 7:12708773-12708795 GTATATATAAATATATAGGTAGG - Intergenic
1020903504 7:14036103-14036125 GTATATGTGGAGATGGAGTTTGG + Intergenic
1022796939 7:33739392-33739414 TTTGATGTGAAAATAGAGGGAGG + Intergenic
1022976510 7:35562582-35562604 TTATAAGTGAAAATGGATGTTGG - Intergenic
1024149685 7:46558354-46558376 GTATTTGTGAATATAGAAGAAGG + Intergenic
1028283192 7:88959696-88959718 GAATTTGTGTCAATAGAGGTGGG - Intronic
1028729745 7:94132175-94132197 GTCTGTGGGAAAATAGAAGTAGG - Intergenic
1030575392 7:111279894-111279916 GGATAGGTCAAGATAGAGGTTGG - Intronic
1030975755 7:116120971-116120993 TTATATGTAAAAATAAAAGTAGG + Intronic
1034140331 7:148809826-148809848 GATTATGTGAAAATGGAGGTAGG - Intronic
1035147638 7:156835865-156835887 TTCTAAGTGAAATTAGAGGTTGG - Intronic
1036377075 8:8209976-8209998 GTGTTTGTGCAAAAAGAGGTTGG + Intergenic
1036852471 8:12213173-12213195 GTGTTTGTGCAAAAAGAGGTTGG - Intergenic
1036873839 8:12455696-12455718 GTGTTTGTGCAAAAAGAGGTTGG - Intergenic
1037199520 8:16235060-16235082 AAATAAGTGAAAATAGAAGTGGG + Intronic
1039040399 8:33402530-33402552 GTATATTAGAAAATCAAGGTAGG - Intronic
1041592111 8:59600271-59600293 GTATTTGTGAAATCAGAGTTGGG - Intergenic
1045146363 8:99349035-99349057 TTATATTTGAAAATAGCGGCCGG + Intronic
1045766325 8:105675114-105675136 GAATATGTCAAAATATAGATTGG + Intronic
1045887349 8:107114272-107114294 GTATCTGTGAAGACTGAGGTGGG + Intergenic
1046422039 8:113999232-113999254 GTGTATGTGAAAATAGAAAATGG - Intergenic
1046435755 8:114186872-114186894 GTATATGTGAAATTACATTTAGG + Intergenic
1046604197 8:116352537-116352559 GAATAAGTGAAAATATAGGAGGG - Intergenic
1046837556 8:118819860-118819882 GTACATGTAAAAGTAGAAGTTGG - Intergenic
1046957775 8:120079125-120079147 GTATTTTTTAAAATAGAGATGGG - Intronic
1047319925 8:123769167-123769189 GTATATGTGAGAGCAGAGGGAGG + Intronic
1047331443 8:123892259-123892281 GTAAATGGGAAAAAAGAGGATGG + Intronic
1047887083 8:129263486-129263508 GTATATATGGAAATAGGGATTGG + Intergenic
1048852120 8:138655308-138655330 GTATGTGTAAAGAAAGAGGTTGG + Intronic
1049358631 8:142201250-142201272 TTTTATGGGAAAATAGAGCTGGG - Intergenic
1050126763 9:2364226-2364248 GTCTAAGTGAAAATAGAACTTGG + Intergenic
1051209844 9:14729837-14729859 GGATGTGAGAAAGTAGAGGTTGG - Intergenic
1051215248 9:14790814-14790836 GGATATGTGAAAATGCAGATGGG - Intronic
1051392240 9:16578159-16578181 GTGTATTTGATAAAAGAGGTGGG - Intronic
1051977881 9:22975232-22975254 ATATACGTGAAAACATAGGTTGG - Intergenic
1052236799 9:26220405-26220427 GTAGATCAGAAAATGGAGGTGGG - Intergenic
1052405512 9:28054885-28054907 GAATATGTGAAAGTAGTGCTTGG - Intronic
1054998526 9:71421571-71421593 GTATATGGGAAACTAATGGTAGG - Intronic
1055140299 9:72869537-72869559 GTACATATGGACATAGAGGTGGG - Intergenic
1055217505 9:73884213-73884235 GTCTTTGTGAAAACACAGGTAGG + Intergenic
1055294539 9:74820727-74820749 ATAAATGTAAAAATAGAGGCAGG - Intronic
1058436725 9:104970072-104970094 GTGGAGATGAAAATAGAGGTAGG + Intergenic
1058746454 9:107996510-107996532 GTATATGTGAAAGGAGAACTTGG + Intergenic
1061068193 9:128292251-128292273 GTATAGCTCAAAATAGAGGAGGG - Intergenic
1061106350 9:128533742-128533764 GTTTCTGAGAACATAGAGGTGGG - Exonic
1186329651 X:8518556-8518578 GTAAATCTGGAAATAGAGCTTGG - Intergenic
1186435070 X:9535876-9535898 GGATTGGTGAAACTAGAGGTAGG + Intronic
1186533779 X:10326587-10326609 GTATTTGTGAAAATATTGTTTGG - Intergenic
1186577372 X:10780603-10780625 GTATATTTTTAAATAGAGTTGGG + Intronic
1186752115 X:12631979-12632001 TTTAATGTGAAATTAGAGGTTGG - Intronic
1187520349 X:20007990-20008012 GTATATGTTGAACTAGAGTTTGG + Exonic
1187714935 X:22093250-22093272 ATATATCTGAAATGAGAGGTGGG + Intronic
1188872213 X:35386988-35387010 GTACATCTGAAAATAGAAATTGG - Intergenic
1189925428 X:45948385-45948407 GTATATGTGTATATATATGTAGG + Intergenic
1191871412 X:65748927-65748949 GGATATGTAAAAATAGTGGGTGG - Intergenic
1193462512 X:81807920-81807942 GTATATGTGGCAAAAGATGTGGG + Intergenic
1193782579 X:85721817-85721839 CTATATGTGATAATAGAGCATGG + Intergenic
1193809013 X:86029507-86029529 ATGTATGTGAAAATACAGTTTGG - Intronic
1194190570 X:90831465-90831487 GTTTATGTGAAAATTGTTGTTGG + Intergenic
1196651923 X:118176901-118176923 GTATATGTGGCAATGGGGGTGGG - Intergenic
1197459014 X:126715824-126715846 GTATACCTGAACATAGAGGATGG + Intergenic
1197512250 X:127384677-127384699 TTATATGTGAAAATAAAACTTGG + Intergenic
1199160913 X:144610685-144610707 TTATATTTGATAATATAGGTAGG + Intergenic
1199490008 X:148387598-148387620 CTTTAAGTGAAAACAGAGGTAGG - Intergenic
1201855328 Y:18534840-18534862 TTAGTTGTGAAAATAGGGGTGGG + Intergenic
1201855339 Y:18534932-18534954 TTAGTTGTGAAAATAGGGGTGGG + Intergenic
1201877983 Y:18785453-18785475 TTAGTTGTGAAAATAGGGGTGGG - Intronic
1201877994 Y:18785545-18785567 TTAGTTGTGAAAATAGGGGTGGG - Intronic