ID: 968035538

View in Genome Browser
Species Human (GRCh38)
Location 3:195544570-195544592
Sequence GAACCCTACAGTCATCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968035538_968035539 3 Left 968035538 3:195544570-195544592 CCTCAGGGATGACTGTAGGGTTC 0: 1
1: 0
2: 0
3: 18
4: 138
Right 968035539 3:195544596-195544618 AAACGATTGTTTTTATCGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968035538 Original CRISPR GAACCCTACAGTCATCCCTG AGG (reversed) Intergenic
900457056 1:2781214-2781236 AAGTCCTACAGTCAGCCCTGTGG - Intronic
900674034 1:3872829-3872851 GTCCCCTCCAGTCCTCCCTGTGG + Intronic
903005187 1:20293649-20293671 GAAGCTGACAGACATCCCTGGGG + Intronic
903655761 1:24948003-24948025 GGACCCTCCAGACATCACTGAGG + Intronic
903849297 1:26296628-26296650 GAATTCTACAGTCCTCGCTGTGG - Intronic
904621587 1:31778564-31778586 GATCCCTAAAGTGATCCCTATGG + Intergenic
906926475 1:50123085-50123107 GCACTCTACAGTCCTCCTTGGGG + Intronic
908304673 1:62800166-62800188 GAACCAAAAAGTCTTCCCTGTGG + Intronic
910687342 1:89930658-89930680 GAACGTAACAGTCATACCTGGGG - Intronic
910742404 1:90534255-90534277 GAACCCTCAAGTTATCCCCGGGG + Intergenic
915603295 1:156935899-156935921 GATCCCAACACTCCTCCCTGTGG - Exonic
916769345 1:167892906-167892928 GAACACTACAGCCTTTCCTGAGG - Intronic
917389795 1:174522717-174522739 GAAACCTACAATCATGGCTGAGG + Intronic
917929535 1:179813929-179813951 GAGCCCTGCAGCCAGCCCTGTGG + Exonic
922588808 1:226756836-226756858 GAACCCCTCAGTTATCCATGAGG - Intergenic
1066338526 10:34505581-34505603 ACACCCTACAGGCAGCCCTGTGG + Intronic
1072907384 10:99467022-99467044 GAACCCAACAGACATCGCTGGGG + Intergenic
1074770179 10:116728518-116728540 GAAGCCTACATTCGTCACTGAGG - Intronic
1074836984 10:117304967-117304989 AAATCTTACAGTCAGCCCTGTGG + Intronic
1077446721 11:2595975-2595997 CAACCCCTCAGTCATCCATGAGG - Intronic
1077777662 11:5289390-5289412 CAACCCTACAGTCACCCATTTGG - Intronic
1078946998 11:16079839-16079861 GTATCCTACAGTAATACCTGTGG + Intronic
1083800922 11:65045835-65045857 GAACCCTAGAGCCTTCCCAGAGG - Exonic
1084442060 11:69180191-69180213 GAACAGGACAGACATCCCTGGGG - Intergenic
1084516567 11:69640965-69640987 GAGCCCAAAAGCCATCCCTGAGG - Intergenic
1084891367 11:72238645-72238667 GACCCCCACAGGCACCCCTGGGG - Exonic
1087853442 11:103060499-103060521 AAGTCCTACAGTCATCCCTGTGG - Intergenic
1088012807 11:105023326-105023348 GAACTCTAGATTCTTCCCTGGGG + Intergenic
1088368133 11:109060241-109060263 GAACCCCTCAGCCCTCCCTGAGG - Intergenic
1089350649 11:117819842-117819864 GAACCCAACAGTGGTGCCTGGGG + Intronic
1097730632 12:63124098-63124120 GCACCATTCAGTGATCCCTGAGG + Intergenic
1101178109 12:102178192-102178214 GATCGTTACAGTCATCCATGGGG + Intronic
1101314885 12:103619953-103619975 GAGCCCGAGAGACATCCCTGAGG - Intronic
1102391756 12:112554746-112554768 GAACCCCAAAGTAATTCCTGGGG - Intergenic
1106054574 13:26226479-26226501 GAACCAGGCACTCATCCCTGAGG + Intergenic
1106334063 13:28766488-28766510 AAACCTTTCAGTCACCCCTGAGG - Intergenic
1106837068 13:33645796-33645818 GACCCCCACAGGCATTCCTGTGG - Intergenic
1109869605 13:68316691-68316713 AACCCCTAAAGTCATCCATGAGG + Intergenic
1110288785 13:73780015-73780037 GAACTCTTGAGTCATCCATGAGG - Intronic
1114536416 14:23425784-23425806 GAACCCAGCGGCCATCCCTGAGG - Exonic
1115379036 14:32712799-32712821 GAACCCCTCAGTCATCCATAAGG + Intronic
1115929433 14:38474386-38474408 AAATCCTGCAGTCAGCCCTGTGG + Intergenic
1118729468 14:68656297-68656319 GATACCTATAGTCATCTCTGTGG - Intronic
1119386352 14:74260110-74260132 GAACAAAACAGTCTTCCCTGGGG + Intronic
1120755775 14:88242856-88242878 GAAGCCTAGAGCCCTCCCTGCGG - Intronic
1124231213 15:27947721-27947743 CAACCCCACAGACAGCCCTGAGG + Intronic
1128580933 15:68809112-68809134 GTCCCCTCCAGTCACCCCTGGGG - Intronic
1129933939 15:79433543-79433565 GAACCATGCCGCCATCCCTGAGG + Intronic
1132929884 16:2453679-2453701 GAGCCCTGCAGTCATGCCTCGGG + Intronic
1136558764 16:31025845-31025867 TAACCCTACAGACATCTCTGAGG - Intergenic
1136935296 16:34457259-34457281 TAAAACCACAGTCATCCCTGGGG + Intergenic
1136964522 16:34891321-34891343 TAAAACCACAGTCATCCCTGGGG - Intergenic
1137234020 16:46598095-46598117 GAACCCCTCAATCATCCATGAGG + Intronic
1137600986 16:49756138-49756160 AAACCTTCCAGTCATCTCTGTGG - Intronic
1138948603 16:61882993-61883015 GATACCTCCAGACATCCCTGGGG + Intronic
1139281987 16:65779065-65779087 GAACCCGACAGCCGGCCCTGAGG - Intergenic
1145737029 17:27240246-27240268 TAACCCTACAGTGAGTCCTGAGG - Intergenic
1148027423 17:44598418-44598440 GGACACTTCAGTCAGCCCTGTGG + Intergenic
1152381128 17:79942729-79942751 AAACCCTAGAGTCATCTCTGGGG - Intronic
1154978819 18:21485449-21485471 CAACTCTGCAGTCATCTCTGAGG - Intronic
1155000230 18:21678753-21678775 GAACCCTACAGGAATATCTGAGG + Intronic
1157167830 18:45374670-45374692 GAAAACTTCAGTCATCCGTGTGG + Intronic
1160159143 18:76458288-76458310 AAACCCTACAGACAGCACTGTGG + Intronic
1160981359 19:1818027-1818049 GCACCCTCCAGGTATCCCTGAGG + Intronic
1163292967 19:16392626-16392648 GAACACTTCTGTCATTCCTGAGG - Intronic
1168087962 19:54062411-54062433 GAACCCGATAGTCATCTCTAAGG + Intronic
925656444 2:6155128-6155150 GAATCTTACAGTCATACCTGAGG - Intergenic
929021133 2:37554432-37554454 GAACCCTCCAGTTCTCCATGTGG - Intergenic
930127611 2:47815092-47815114 TACCCCTAAAGTCATCCATGAGG + Intronic
932341256 2:70963779-70963801 GAACCATGCAGTCTTCCCTGTGG - Intronic
935299027 2:101676729-101676751 GAAGCCCACAGTGATCTCTGAGG + Intergenic
940375601 2:152954773-152954795 GAACCCTTCACTCATCACTGGGG - Intergenic
941115664 2:161469196-161469218 AATCCCTAGAGGCATCCCTGTGG - Intronic
941918496 2:170827654-170827676 GATCCCTCCTGTCATCTCTGTGG + Intronic
943694972 2:190917425-190917447 GGACCCCTCAGTCATCCATGAGG + Intronic
1170703794 20:18727309-18727331 CAAGCCTACATTCATGCCTGGGG - Intronic
1171283824 20:23921968-23921990 GAACACTACAGTCACCCCGCAGG - Intergenic
1174174918 20:48638549-48638571 GAGTCCTGCAGTCCTCCCTGGGG - Intronic
1174927649 20:54778176-54778198 GCTTCCTACAGTCATCCCTGGGG - Intergenic
1175568748 20:60002281-60002303 GAACCCAACATTCATCAATGCGG - Intronic
1176887722 21:14275969-14275991 GAGCCCTTAAGTCCTCCCTGAGG + Intergenic
1178163589 21:29946699-29946721 GATCCTTACAGGCCTCCCTGAGG + Intergenic
1182149946 22:28020903-28020925 GGACCCGACAGACCTCCCTGTGG + Intronic
1183273993 22:36879838-36879860 TAGGACTACAGTCATCCCTGAGG + Intergenic
1183750551 22:39717845-39717867 GAATCCTAAAGTCATTCCAGAGG - Intergenic
1184255685 22:43285573-43285595 GAGCCCAACAGTTTTCCCTGAGG + Intronic
950818012 3:15727675-15727697 GAATCCCTCAGTCATCCATGAGG - Intronic
951164225 3:19465769-19465791 GAACCCCTCAGTCATCCATGAGG - Intronic
955360405 3:58269213-58269235 GACCCAGACAGCCATCCCTGGGG - Intronic
956956603 3:74348560-74348582 GAAGCCTACACTCACCCATGCGG + Intronic
961613260 3:128158058-128158080 GAACCCCTCAGTCATCCATGAGG - Intronic
965235751 3:166119277-166119299 GAACCATTCAGTCATCCAGGAGG - Intergenic
965507998 3:169537198-169537220 GAATCATACAGTCATTCCAGAGG - Intronic
968035538 3:195544570-195544592 GAACCCTACAGTCATCCCTGAGG - Intergenic
969534928 4:7750397-7750419 CAACCCTGCAGTCATCCTTTGGG - Intergenic
969556064 4:7911160-7911182 GACCCCTCCACTCCTCCCTGGGG + Intronic
974570088 4:63634487-63634509 GAACCTTACAGCTATACCTGAGG - Intergenic
978566616 4:110089408-110089430 CAAGCCTGCAGTCAGCCCTGAGG - Intronic
982905024 4:161057198-161057220 CAACACCAGAGTCATCCCTGAGG + Intergenic
987066825 5:14297885-14297907 GACAGCTACAGCCATCCCTGCGG - Intronic
989549575 5:42718515-42718537 CAACCCAAGAGTCATCACTGTGG - Exonic
990283629 5:54277923-54277945 AAACCAAACAGTCACCCCTGTGG + Intronic
993893297 5:93501116-93501138 GAACCCCTCAGTCATCCATGAGG - Intergenic
996544211 5:124660499-124660521 GAACTCTGCAGTCATTTCTGAGG + Intronic
997349238 5:133218419-133218441 GAATTTTACAGTGATCCCTGTGG - Intronic
997614102 5:135234740-135234762 GAACCCTGCACACAACCCTGAGG - Intronic
998650377 5:144113292-144113314 GAACAATACAGTCATAACTGAGG - Intergenic
999101393 5:149028636-149028658 GAACCTGACATTCATCCTTGAGG - Intronic
1000142297 5:158417221-158417243 AAACCCCACAGTCATGGCTGTGG + Intergenic
1001638155 5:173227546-173227568 GGACCCCAAAGCCATCCCTGTGG - Intergenic
1001655995 5:173350485-173350507 GAACCCCTCAGTCATCTATGAGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002348749 5:178567048-178567070 GAAAGCTACAGTGAACCCTGTGG + Intronic
1003414114 6:5892921-5892943 CAACCCAACAGTCGTCCCTGGGG + Intergenic
1004550437 6:16641917-16641939 AAACCCTCAAGTCATCCATGGGG - Intronic
1006396544 6:33791048-33791070 GAACCCTGTTGTCTTCCCTGTGG + Intergenic
1006748611 6:36362707-36362729 GAACTCTGCACTCAGCCCTGAGG - Intronic
1006778247 6:36613311-36613333 AAACCCCTCAGTCATCCATGTGG - Intergenic
1010941774 6:81927483-81927505 GAAGCCCTCATTCATCCCTGTGG - Intergenic
1011089838 6:83585082-83585104 GAACATTACAGTCATTCATGAGG + Intronic
1013353681 6:109328788-109328810 AAATCCTGCAGTCAGCCCTGGGG - Intergenic
1013666397 6:112353505-112353527 GAAGGCTACAGGGATCCCTGAGG + Intergenic
1019301403 7:305926-305948 GTGACCTGCAGTCATCCCTGGGG + Intergenic
1020448217 7:8292323-8292345 GAACCCTAGAGTGTTTCCTGTGG - Intergenic
1024690942 7:51802835-51802857 CAACCCTACAGCCAGCCCTGTGG + Intergenic
1025739415 7:64183485-64183507 AAACCCGACCGCCATCCCTGGGG - Intronic
1029050032 7:97676284-97676306 GAACCCCTCAGTCATCTCTGAGG - Intergenic
1031747008 7:125512192-125512214 GAACCTCAAAGTCATCCATGAGG + Intergenic
1032074961 7:128831890-128831912 GAGTCCTGCAGTCATCCCTGAGG + Intronic
1034840122 7:154387716-154387738 AAAGCCTACAGTAATCCCTTTGG - Intronic
1038055183 8:23851351-23851373 GAACCCTGAAGCCATCACTGAGG - Exonic
1041985336 8:63916046-63916068 AAACGCGCCAGTCATCCCTGTGG + Intergenic
1045461534 8:102429878-102429900 AAACCCTACACTCATTACTGTGG + Intergenic
1045806477 8:106168250-106168272 GAACCTTTCAGTCCTCCCTGGGG + Intergenic
1047017878 8:120742900-120742922 GAAACCAACAGTGATCTCTGGGG + Intronic
1047226052 8:122956212-122956234 GAACCCTATTGTCCTCTCTGGGG - Intronic
1048209101 8:132440204-132440226 GATGCCAACAGTCATCTCTGTGG + Intronic
1048248293 8:132833478-132833500 GAACCTTACAATCATTGCTGCGG + Intronic
1051576500 9:18622141-18622163 TAACCCTCCCTTCATCCCTGAGG - Intronic
1053050815 9:34958936-34958958 GAACCCTACAGGGATCCCGGTGG - Intronic
1056709357 9:88978125-88978147 GAACCCTTCAGGCTTCCCAGTGG - Intergenic
1056839183 9:89984567-89984589 GAACCAGACAGTCAGTCCTGTGG + Intergenic
1060488630 9:124065562-124065584 GCACCCCACAGTGGTCCCTGGGG + Intergenic
1061510464 9:131057929-131057951 GACTCCTGCAGACATCCCTGCGG + Intronic
1185479429 X:435095-435117 GGACCCTACAGTGATCCGTGTGG + Intergenic
1185718232 X:2360639-2360661 TAACCCTTCAGTCATTCCAGAGG - Intronic
1186455653 X:9708082-9708104 GGGCCCTATAGTCACCCCTGAGG + Intronic
1189794412 X:44633754-44633776 GAACCGTCCAGCCATCCTTGAGG - Intergenic
1190006102 X:46739610-46739632 GAAAGCTACTTTCATCCCTGGGG - Intronic
1192040316 X:67613331-67613353 GAACTCCACAGTTCTCCCTGAGG + Intronic
1193833506 X:86315658-86315680 GAATACCTCAGTCATCCCTGAGG - Intronic
1195991153 X:110683743-110683765 GAACCCCAGGCTCATCCCTGGGG + Intronic
1196557854 X:117111591-117111613 GAACCATCCATGCATCCCTGGGG - Intergenic
1198600525 X:138280100-138280122 GAACCATACTTGCATCCCTGGGG + Intergenic
1198925665 X:141791450-141791472 GAACTCTGCAGCCATTCCTGTGG - Intergenic
1202334243 Y:23790055-23790077 GGACCCTAGGGTCATCCATGTGG + Intergenic
1202536525 Y:25880004-25880026 GGACCCTAGGGTCATCCATGTGG - Intergenic