ID: 968036583

View in Genome Browser
Species Human (GRCh38)
Location 3:195553055-195553077
Sequence CTGGAGTCTCAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968036583_968036592 17 Left 968036583 3:195553055-195553077 CCATCCTCCCTCTGAGACTCCAG No data
Right 968036592 3:195553095-195553117 CTTCTCCTAGCTTCCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968036583 Original CRISPR CTGGAGTCTCAGAGGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr