ID: 968036592

View in Genome Browser
Species Human (GRCh38)
Location 3:195553095-195553117
Sequence CTTCTCCTAGCTTCCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968036583_968036592 17 Left 968036583 3:195553055-195553077 CCATCCTCCCTCTGAGACTCCAG No data
Right 968036592 3:195553095-195553117 CTTCTCCTAGCTTCCAGTCCTGG No data
968036588_968036592 9 Left 968036588 3:195553063-195553085 CCTCTGAGACTCCAGGTAGGATC No data
Right 968036592 3:195553095-195553117 CTTCTCCTAGCTTCCAGTCCTGG No data
968036585_968036592 13 Left 968036585 3:195553059-195553081 CCTCCCTCTGAGACTCCAGGTAG No data
Right 968036592 3:195553095-195553117 CTTCTCCTAGCTTCCAGTCCTGG No data
968036589_968036592 -2 Left 968036589 3:195553074-195553096 CCAGGTAGGATCTTTTCCTGCCT No data
Right 968036592 3:195553095-195553117 CTTCTCCTAGCTTCCAGTCCTGG No data
968036587_968036592 10 Left 968036587 3:195553062-195553084 CCCTCTGAGACTCCAGGTAGGAT No data
Right 968036592 3:195553095-195553117 CTTCTCCTAGCTTCCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968036592 Original CRISPR CTTCTCCTAGCTTCCAGTCC TGG Intergenic
No off target data available for this crispr