ID: 968036916

View in Genome Browser
Species Human (GRCh38)
Location 3:195555315-195555337
Sequence CCTACCTCCTGCCCTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968036916_968036927 26 Left 968036916 3:195555315-195555337 CCCCTCCCAGGGCAGGAGGTAGG No data
Right 968036927 3:195555364-195555386 TCTGCTTTAGTCAGCTGCCTGGG No data
968036916_968036926 25 Left 968036916 3:195555315-195555337 CCCCTCCCAGGGCAGGAGGTAGG No data
Right 968036926 3:195555363-195555385 CTCTGCTTTAGTCAGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968036916 Original CRISPR CCTACCTCCTGCCCTGGGAG GGG (reversed) Intergenic