ID: 968038259

View in Genome Browser
Species Human (GRCh38)
Location 3:195567051-195567073
Sequence AGGTGGGCATGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5103
Summary {0: 1, 1: 0, 2: 24, 3: 313, 4: 4765}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968038259_968038272 18 Left 968038259 3:195567051-195567073 CCCTCCTCCCTCCATGCCCACCT 0: 1
1: 0
2: 24
3: 313
4: 4765
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038259_968038273 19 Left 968038259 3:195567051-195567073 CCCTCCTCCCTCCATGCCCACCT 0: 1
1: 0
2: 24
3: 313
4: 4765
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038259_968038270 3 Left 968038259 3:195567051-195567073 CCCTCCTCCCTCCATGCCCACCT 0: 1
1: 0
2: 24
3: 313
4: 4765
Right 968038270 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 2
3: 19
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968038259 Original CRISPR AGGTGGGCATGGAGGGAGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr