ID: 968038270

View in Genome Browser
Species Human (GRCh38)
Location 3:195567077-195567099
Sequence CCTCACTGCCTTTTTGCTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 169}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968038255_968038270 26 Left 968038255 3:195567028-195567050 CCGCAGGCAGAGCCCAGGAGAGG 0: 1
1: 1
2: 8
3: 82
4: 696
Right 968038270 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 2
3: 19
4: 169
968038263_968038270 -5 Left 968038263 3:195567059-195567081 CCTCCATGCCCACCTCCTCCTCA 0: 1
1: 6
2: 19
3: 202
4: 1501
Right 968038270 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 2
3: 19
4: 169
968038258_968038270 13 Left 968038258 3:195567041-195567063 CCAGGAGAGGCCCTCCTCCCTCC 0: 1
1: 0
2: 8
3: 83
4: 492
Right 968038270 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 2
3: 19
4: 169
968038262_968038270 -4 Left 968038262 3:195567058-195567080 CCCTCCATGCCCACCTCCTCCTC 0: 1
1: 2
2: 17
3: 173
4: 1542
Right 968038270 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 2
3: 19
4: 169
968038257_968038270 14 Left 968038257 3:195567040-195567062 CCCAGGAGAGGCCCTCCTCCCTC 0: 1
1: 0
2: 5
3: 55
4: 459
Right 968038270 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 2
3: 19
4: 169
968038264_968038270 -8 Left 968038264 3:195567062-195567084 CCATGCCCACCTCCTCCTCACTG 0: 1
1: 0
2: 6
3: 156
4: 1215
Right 968038270 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 2
3: 19
4: 169
968038261_968038270 -1 Left 968038261 3:195567055-195567077 CCTCCCTCCATGCCCACCTCCTC 0: 1
1: 1
2: 24
3: 207
4: 2016
Right 968038270 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 2
3: 19
4: 169
968038259_968038270 3 Left 968038259 3:195567051-195567073 CCCTCCTCCCTCCATGCCCACCT 0: 1
1: 0
2: 24
3: 313
4: 4765
Right 968038270 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 2
3: 19
4: 169
968038260_968038270 2 Left 968038260 3:195567052-195567074 CCTCCTCCCTCCATGCCCACCTC 0: 1
1: 1
2: 32
3: 262
4: 2086
Right 968038270 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 2
3: 19
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968038270 Original CRISPR CCTCACTGCCTTTTTGCTAA CGG Intergenic
901659118 1:10787696-10787718 CCTCGCTGCCTCTTTGCTGATGG - Intronic
902637412 1:17743614-17743636 CTTCAGTGTCTTTTTGCTCAAGG - Intergenic
903276104 1:22222838-22222860 CATCATTGCCATTTTGCAAATGG - Intergenic
903383011 1:22909735-22909757 CCTGTCTTCATTTTTGCTAATGG - Intronic
903559018 1:24214130-24214152 CCACACTGCCTTTATGACAATGG + Intergenic
904322396 1:29706313-29706335 CCCCACTGTCATTTTGTTAAGGG + Intergenic
906721782 1:48011421-48011443 TCTCTTTTCCTTTTTGCTAATGG + Intergenic
908203938 1:61825668-61825690 CCTCACTGCTCTGTTGCTAAAGG - Intronic
911438253 1:97890957-97890979 ACTCACTGCCTTTTTGCAAAAGG - Intronic
911460343 1:98181503-98181525 CCTCACTACCTGTCTGCTGATGG + Intergenic
917163701 1:172087327-172087349 ACTCACTGCATTATTCCTAATGG + Intronic
917895970 1:179487326-179487348 GCTCAAAGACTTTTTGCTAATGG - Intronic
920340924 1:205274719-205274741 CCGCACCCCCTTTTTTCTAAAGG - Intergenic
920852356 1:209636686-209636708 CCTCCCGGCCTTTGTGCTTATGG + Intronic
920887127 1:209939612-209939634 CCTCACTGTCCTTTTACCAAAGG + Intronic
922793448 1:228323718-228323740 CCTCACTGTCTTGTGGCTGATGG + Intronic
923186121 1:231575152-231575174 CCACCCTCCCTTTTGGCTAATGG + Intronic
1064662928 10:17624295-17624317 TCTCAATGCCTTTGTTCTAAAGG - Intergenic
1065321776 10:24516735-24516757 CCTCACTGCCTTTTGCCTGACGG - Intronic
1066100635 10:32115134-32115156 CCTCACAGTGTCTTTGCTAAAGG + Intergenic
1067540040 10:47144462-47144484 CCTCACTCCTTTTTCTCTAAAGG - Intergenic
1067974961 10:51013851-51013873 CCTCACTACATTATTGCCAAAGG - Intronic
1068465738 10:57388075-57388097 CATCACAGCCTATTTGCCAATGG + Intergenic
1068940980 10:62681053-62681075 CCTCACTGCTTTCTAGCTGATGG + Intergenic
1070486512 10:76937099-76937121 CCTGACTGTCTCTTTGCTAAAGG - Intronic
1071950343 10:90696856-90696878 TCCCACTGCCTCTTTGGTAATGG + Intergenic
1073839996 10:107487463-107487485 CCACATTGCCTTTTTGCAATCGG - Intergenic
1075508818 10:123052062-123052084 CCTCACTGCCACTTTGAAAAAGG - Intronic
1076823059 10:132951259-132951281 CCTCACTGCCTTCCCGCTTACGG - Intergenic
1081936614 11:46908637-46908659 ACTCACTGCATATTTGCTATTGG - Intronic
1085872559 11:80367709-80367731 TCTCACTGCCTTCCTGCCAAAGG - Intergenic
1087768209 11:102179184-102179206 TCTCTCTTCCTTTTTGCTATAGG + Intronic
1089029121 11:115304881-115304903 GGTCACTGCCTTTTTGCTTATGG + Intronic
1092505072 12:9090397-9090419 CCTCACTGCATCTGTGCAAACGG - Exonic
1093774040 12:23051775-23051797 CCTCACTGCCCTTTGTGTAAAGG + Intergenic
1094698986 12:32850244-32850266 CCTGAATTCCTTTTTTCTAAAGG - Intronic
1095668518 12:44831751-44831773 CCACACTGCCATTTTCCTCATGG - Intronic
1099276576 12:80583892-80583914 CCTGGCTGGCTTTTAGCTAAGGG + Intronic
1099538739 12:83878184-83878206 CATCACAGCTTTTTTGCTAAAGG - Intergenic
1100162950 12:91882280-91882302 CCTCATTCCATTTTTGCAAAGGG + Intergenic
1100694043 12:97071708-97071730 TCTCAGTGCTTTTTTTCTAATGG + Intergenic
1103591813 12:121996788-121996810 CCTAAATACCTTTTTGATAAGGG - Intronic
1103741014 12:123091598-123091620 CCTCTCTGCCTTTGTGCCATAGG - Intronic
1104441791 12:128799216-128799238 CCTCACTGGCTATTTTCAAAAGG + Intronic
1105681723 13:22735561-22735583 CCTGACTGCCTGTTTGCGAATGG + Intergenic
1105683331 13:22752197-22752219 CCTCACTGTCTTTTTCCCACAGG + Intergenic
1108685550 13:52815789-52815811 CCCCACTACCTTTTTCATAATGG - Intergenic
1109523783 13:63547221-63547243 TCTCTCTGCCTATTTGCTAAGGG + Intergenic
1110124688 13:71927908-71927930 CTTCACTGCCATTTTGCCACTGG - Intergenic
1110647501 13:77905244-77905266 CATCACATACTTTTTGCTAAGGG + Intronic
1111277365 13:85967423-85967445 CCTCAATTCCTTTTAGCCAATGG - Intergenic
1112773844 13:102823009-102823031 CCTAACAGACTTCTTGCTAAAGG + Intronic
1113575381 13:111391610-111391632 CCTCACTGCCCTTGTGCTTTGGG + Intergenic
1115354054 14:32428285-32428307 CATCACTGCTTGTTTGCAAAAGG + Intronic
1116387540 14:44349570-44349592 CCTCACTGGCTGTTGGCTATAGG + Intergenic
1116397546 14:44464694-44464716 CCTGACTGAGTTTTTGCCAAAGG - Intergenic
1117993199 14:61454974-61454996 CCTCATTTCCTTTTTACTGAAGG + Intronic
1121563377 14:94890971-94890993 GCTCAGTGCTTTTCTGCTAACGG + Intergenic
1128528322 15:68427547-68427569 CCTCACTGACTTTTTCCTCCAGG + Intronic
1129354912 15:74983814-74983836 CCTCCCTGCCTTTCTTCTACTGG - Intronic
1130290476 15:82595454-82595476 TGTTACTGCCTTTTTGCTACAGG + Intronic
1134341308 16:13349187-13349209 CCTCACTGGCATTTTGCTGGTGG - Intergenic
1134762065 16:16723245-16723267 CCTCACTCCCTTTCTCCTGAGGG + Intergenic
1135181476 16:20278216-20278238 CCACAATGCCTTCTTGTTAAAGG - Intergenic
1135677444 16:24428947-24428969 GCTCACTTCCTTATTGCTCAAGG + Intergenic
1136036927 16:27547644-27547666 TCTCACTGTCCTTTTGATAAAGG + Intronic
1138340760 16:56287578-56287600 CCTCACTGCCTGTTAGTGAAGGG + Intronic
1138574626 16:57899762-57899784 CCTCTCTACCTTTTTGTTAAGGG - Intronic
1142285255 16:89168973-89168995 CCCCACTGCCTCTTCGGTAACGG + Intergenic
1144932040 17:18867442-18867464 CCTGCCTGACTTCTTGCTAATGG - Intronic
1146318149 17:31825454-31825476 CCTTACTACCATTTTGCAAATGG + Intergenic
1148240342 17:45996204-45996226 CCTCCCTGCCTTTTTGCTTAGGG - Intronic
1151022804 17:70638426-70638448 CCTCACTGCCTTCTACCTAAAGG - Intergenic
1153132024 18:1865382-1865404 CCTCAATGCCTTTTAGCCAATGG + Intergenic
1156502805 18:37570333-37570355 CTTCACTGCCTCTTTCCTTAAGG - Intergenic
1157280443 18:46343623-46343645 CTTCACTGCCTATCTGCCAAGGG + Intronic
1157387272 18:47268307-47268329 CCTCAGTCCCTTTTTGCTGCCGG + Intergenic
1158985695 18:62814288-62814310 ACTAACTGCTTTTTAGCTAATGG - Intronic
1160571483 18:79820225-79820247 CCTCCCCACCTTTTGGCTAATGG + Intergenic
1160968282 19:1756054-1756076 CCCCTCTGCCTCTTTGCTAGTGG - Intronic
1163198760 19:15746722-15746744 CCTTACTGCCATATTGCTAAAGG - Intergenic
926909454 2:17837124-17837146 CCTAACTTCCCTTTTGCTAAGGG - Intergenic
929639973 2:43568182-43568204 TCTCACAGCCTTTTTATTAAAGG + Intronic
930828608 2:55719131-55719153 CCTGACTGCCATTTGCCTAAGGG - Intergenic
931893904 2:66707274-66707296 CCTCACTGGCTGTTTGCTGGAGG - Intergenic
932291480 2:70583758-70583780 TCTCACTACCTTTTTTATAAGGG + Intergenic
932588071 2:73044670-73044692 CCTCACAGCCTTTGTGTTCAGGG - Intronic
933561436 2:83890871-83890893 CCTTAGTGCCTTGTTTCTAATGG - Intergenic
934947067 2:98549919-98549941 CCTCCCTGCCTTTTCTCTACTGG + Intronic
936238532 2:110767358-110767380 CCTGACTGCCTTTGTTCTGAGGG - Intronic
936584299 2:113740292-113740314 CCTCCCTGCCTTTCTGCCTACGG - Intronic
937091891 2:119212079-119212101 CCTCACTGTCATTTTCCAAAAGG + Intergenic
939966638 2:148616810-148616832 CCTCCCTGCCTGTTGCCTAATGG + Intergenic
940768211 2:157812415-157812437 CCTCCTTGCCTTTTTTTTAATGG - Intronic
942892859 2:181013468-181013490 CCTCACTGGCTGTTGGCAAATGG + Intronic
943267647 2:185755712-185755734 CCTCACTGCATGTGTGCTCAAGG - Intronic
948122670 2:235542978-235543000 CCTGACTTCCTGTTTGCTGAGGG + Intronic
948639153 2:239362732-239362754 CCTCACTCCCTGTTTGGTGAAGG - Intronic
1170550317 20:17470782-17470804 CCTCATTCCCTTATTGCAAAAGG + Intronic
1172758627 20:37306165-37306187 CCTCTTTGCCGTTTTGCTCAGGG + Intronic
1173470638 20:43320869-43320891 ACTCACTTCCTTATTTCTAATGG - Intergenic
1173939421 20:46897264-46897286 CCACAGAGCCTTTTTGCTGAGGG - Intronic
1174286584 20:49478407-49478429 TCACACTGCCTTTTGCCTAATGG + Intronic
1177706541 21:24713717-24713739 CCTCACTAAGTTTATGCTAAGGG - Intergenic
1178807522 21:35851837-35851859 CCTTAATGCCATTTTGCTCATGG - Intronic
1178952708 21:36998345-36998367 CCTGACAGCCTTTTTTTTAAGGG + Intergenic
1179169222 21:38959808-38959830 CCTCACTGTCTTATTGCAATTGG - Intergenic
1183081264 22:35458206-35458228 CCTCAGTGTCTTTTTGGAAATGG + Intergenic
1183954645 22:41372124-41372146 CCTCACTGCCTCTTTCTAAATGG + Intronic
1184462768 22:44648687-44648709 CCTGACTGGCTTTCTGCTGATGG + Intergenic
949811816 3:8014358-8014380 CATCCCTTCCTTGTTGCTAAAGG + Intergenic
950614029 3:14145404-14145426 CCTCACTGCCTCTTTGCAGTAGG - Exonic
952137386 3:30438403-30438425 CCTCACATCCTTTTTGATAATGG + Intergenic
952150307 3:30581728-30581750 CCTCACTTCCTTTCTCCTGAGGG + Intergenic
954426753 3:50447428-50447450 CCTCACCGCCTCCTTGCTCAGGG - Intronic
957211280 3:77261733-77261755 CCTCATTGCTTTGTTGCCAAAGG + Intronic
966176634 3:177145489-177145511 CCTTACTGCCTTTATTCTAGAGG - Intronic
967070859 3:185961288-185961310 ACCCTCTGCCTTTTTGCAAAAGG + Intergenic
967753218 3:193138580-193138602 CCTCATTTCCCTTTTGCTATAGG - Intergenic
968038270 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG + Intergenic
969992125 4:11275493-11275515 GCTCACTGCTTTTTAGCTAGAGG + Intergenic
971483156 4:27132114-27132136 CCTCACTGTCTTGATGCTGATGG - Intergenic
975037814 4:69706405-69706427 CCTCACTTCCCATTTGCTACTGG + Intergenic
975314040 4:72931679-72931701 CATCATTGCCTTTGTGCTCAGGG + Intergenic
975815596 4:78213401-78213423 CCTGACTGCATTTTGGCCAACGG - Intronic
975941359 4:79650870-79650892 TCTCACTTCCTAATTGCTAAAGG - Intergenic
976889373 4:90027700-90027722 CTTCACTTCCTTATTACTAAAGG - Intergenic
977758006 4:100696670-100696692 CCTCACTGCCGATTAGATAATGG + Intronic
980270784 4:130581341-130581363 CCTTACTTCCTTTTTGGTATGGG - Intergenic
981274316 4:142880087-142880109 CCTCACTGCCACATTTCTAAAGG + Intergenic
981627757 4:146778817-146778839 CCTCACTGCCTTCTTCCTTTTGG - Intronic
982401401 4:154972003-154972025 GCTCAATGCCTCTTTGCTATAGG + Intergenic
982501699 4:156165266-156165288 CCCAACTGCCTATTTTCTAAAGG - Intergenic
982857477 4:160403253-160403275 CCTCACTGGCTGTTGGCTAGAGG - Intergenic
983358408 4:166695939-166695961 GCTCACAGTCCTTTTGCTAAAGG + Intergenic
985392984 4:189511606-189511628 CTTCAGTGCCCTTTTCCTAACGG - Intergenic
986094719 5:4543157-4543179 CTACACAGCCTTTTAGCTAATGG + Intergenic
989723978 5:44565557-44565579 CCTCACTACCACATTGCTAAAGG - Intergenic
992474107 5:77086011-77086033 CTTCTCTGCCTTTTAGCTAATGG - Intronic
994137672 5:96306405-96306427 CCTCACTGACTTTTTTTGAAGGG + Intergenic
996300233 5:121973218-121973240 CCTCACTGCACTGTTACTAATGG - Intronic
998080609 5:139272422-139272444 CCTCACAGCCTTATTTATAATGG + Intronic
998383636 5:141743403-141743425 CTACACTGCCTTTTCGGTAAAGG + Intergenic
1001454147 5:171848049-171848071 GCTCACTGTCCTTTTGCAAATGG - Intergenic
1002875278 6:1204469-1204491 CCTCACAGGATTCTTGCTAAAGG + Intergenic
1007336030 6:41155766-41155788 CCTCACTCCCTTGTTCCCAAAGG - Intergenic
1009037965 6:58140795-58140817 GTTCACTGTCTTTTTGCTCATGG - Intergenic
1009213755 6:60894431-60894453 GTTCACTGTCTTTTTGCTCATGG - Intergenic
1012686290 6:102254302-102254324 CCTAACTCCCTTTTGACTAATGG + Intergenic
1015034012 6:128630565-128630587 CCTCAGTTCTTTTTGGCTAAGGG + Intergenic
1017574121 6:155782531-155782553 CCTCACAGGATTTTTGCTGAAGG - Intergenic
1019996128 7:4725542-4725564 CCTCACTGCCTTTGTGCGGCCGG + Intronic
1021498502 7:21303357-21303379 CCTTAGTGTCATTTTGCTAAAGG - Intergenic
1022220781 7:28311659-28311681 CCTGACTCCCTGTTTTCTAAAGG - Intronic
1023128441 7:36978212-36978234 CCTCACTCCCTGTTGGCTCATGG + Intronic
1023481780 7:40642821-40642843 CCTCACCGCCTCCTTGCTCATGG + Intronic
1023811371 7:43914924-43914946 CCTTACTGCATTTGTGTTAAGGG - Intronic
1026616127 7:71906335-71906357 CCTCACTGCCTGCTGGCTCATGG - Intronic
1029666426 7:101998035-101998057 CCACACTGCACTTTTGCTAAAGG - Intronic
1030349715 7:108470006-108470028 CCTCTTTGCCTTTTTGAAAAGGG + Intergenic
1030836471 7:114293403-114293425 CCTTCCTGGCTGTTTGCTAAAGG - Intronic
1033387219 7:140889741-140889763 CCTCACTGACTTTTGACTGATGG - Intronic
1033548722 7:142425908-142425930 CCTGGCTGCCTTTCTTCTAAGGG + Intergenic
1033640137 7:143255396-143255418 GCTAACTTCCTTTTTGCTTAAGG + Intronic
1034479285 7:151307446-151307468 CCTCACTCCCTTTGTCCTCATGG + Intergenic
1037093134 8:14947262-14947284 CCTCACTGTGTGTTTGCTAATGG - Intronic
1037403247 8:18515147-18515169 CCTCACTGCCTCATTGGCAATGG + Intergenic
1039900272 8:41746893-41746915 CCCCACTGCCCTTCTTCTAAAGG - Intronic
1041193560 8:55377530-55377552 CCTCACTGCTTTTTCCCTTAAGG + Intronic
1045704878 8:104910888-104910910 TCTCACTGGCTATCTGCTAAAGG - Intronic
1046710023 8:117500075-117500097 CCTCACTGCCTCTTTGTCAAGGG + Intergenic
1046764693 8:118056940-118056962 CCTCCATGGCTTTTTGGTAATGG - Intronic
1050633267 9:7582780-7582802 GCCCACTTCCTTGTTGCTAAAGG - Intergenic
1050701805 9:8348099-8348121 CCTCACTGCCTTTCAGCCGATGG - Intronic
1057405902 9:94770541-94770563 CCTCACTGACTGTTGGCCAAAGG + Intronic
1057535978 9:95906802-95906824 TCTCAGTGCCTTTTTGGTAGGGG + Intronic
1187723636 X:22178954-22178976 CATCACTGACATTTTGCTAAGGG - Intronic
1187830671 X:23378239-23378261 CATCACTGTCTTTTTGAAAATGG - Intronic
1188410883 X:29870784-29870806 TCTCACTTCCTTCTTGCTTATGG - Intronic
1189109216 X:38269997-38270019 CCTGACTGCCTTTTGGTGAAAGG - Intronic
1194615984 X:96103817-96103839 CTTCACTTAATTTTTGCTAATGG - Intergenic
1195319539 X:103710468-103710490 CCTAACTGACTCTTGGCTAAGGG + Intronic
1195397620 X:104428307-104428329 CATCACTGCTTTTTTGCTTTGGG + Intergenic
1196591777 X:117493913-117493935 CTTCAGGTCCTTTTTGCTAAAGG - Intergenic
1197131755 X:123013914-123013936 CCTGCCTGCCTTTTTGTGAATGG - Intergenic
1198419850 X:136460376-136460398 CCTCACTTCATTTTTGACAAAGG - Intergenic
1198806378 X:140499440-140499462 CCTCACTGCCCTCTTGAGAAGGG - Intergenic
1200821694 Y:7591001-7591023 CCTAACTGGCTATTAGCTAAAGG + Intergenic
1200876753 Y:8164409-8164431 CCTAACTGGCTATTAGCTAAAGG + Intergenic
1202103717 Y:21339256-21339278 CCTAACTGGCTATTAGCTAAAGG + Intergenic
1202238611 Y:22741753-22741775 CCTAACTGGCTATTAGCTAAAGG - Intergenic