ID: 968038272

View in Genome Browser
Species Human (GRCh38)
Location 3:195567092-195567114
Sequence GCTAACGGCTTTCAGCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968038268_968038272 -5 Left 968038268 3:195567074-195567096 CCTCCTCACTGCCTTTTTGCTAA 0: 1
1: 0
2: 0
3: 26
4: 298
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038269_968038272 -8 Left 968038269 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038260_968038272 17 Left 968038260 3:195567052-195567074 CCTCCTCCCTCCATGCCCACCTC 0: 1
1: 1
2: 32
3: 262
4: 2086
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038263_968038272 10 Left 968038263 3:195567059-195567081 CCTCCATGCCCACCTCCTCCTCA 0: 1
1: 6
2: 19
3: 202
4: 1501
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038265_968038272 2 Left 968038265 3:195567067-195567089 CCCACCTCCTCCTCACTGCCTTT 0: 1
1: 0
2: 8
3: 110
4: 962
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038264_968038272 7 Left 968038264 3:195567062-195567084 CCATGCCCACCTCCTCCTCACTG 0: 1
1: 0
2: 6
3: 156
4: 1215
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038259_968038272 18 Left 968038259 3:195567051-195567073 CCCTCCTCCCTCCATGCCCACCT 0: 1
1: 0
2: 24
3: 313
4: 4765
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038267_968038272 -2 Left 968038267 3:195567071-195567093 CCTCCTCCTCACTGCCTTTTTGC 0: 1
1: 0
2: 2
3: 69
4: 656
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038262_968038272 11 Left 968038262 3:195567058-195567080 CCCTCCATGCCCACCTCCTCCTC 0: 1
1: 2
2: 17
3: 173
4: 1542
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038258_968038272 28 Left 968038258 3:195567041-195567063 CCAGGAGAGGCCCTCCTCCCTCC 0: 1
1: 0
2: 8
3: 83
4: 492
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038266_968038272 1 Left 968038266 3:195567068-195567090 CCACCTCCTCCTCACTGCCTTTT 0: 1
1: 1
2: 15
3: 150
4: 1464
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038257_968038272 29 Left 968038257 3:195567040-195567062 CCCAGGAGAGGCCCTCCTCCCTC 0: 1
1: 0
2: 5
3: 55
4: 459
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
968038261_968038272 14 Left 968038261 3:195567055-195567077 CCTCCCTCCATGCCCACCTCCTC 0: 1
1: 1
2: 24
3: 207
4: 2016
Right 968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968038272 Original CRISPR GCTAACGGCTTTCAGCCTTT TGG Intergenic
905918414 1:41701829-41701851 GCTTAAGGCTTTGAGCCCTTGGG + Intronic
909561464 1:77013406-77013428 GCTAAAGGCTTTCTGAGTTTTGG + Intronic
910928326 1:92418597-92418619 CCTAAAGGCCTTCAGCCTCTGGG - Intergenic
912469556 1:109897073-109897095 GCTGAGGGCTTTCAGCCAATCGG + Intergenic
919403110 1:197145195-197145217 GCTAACGGTTTTCATACTTTTGG + Intronic
920965566 1:210698127-210698149 CTTAACTGCTTTCAACCTTTAGG - Intronic
924571008 1:245237604-245237626 GTTTACTACTTTCAGCCTTTCGG + Intronic
924642182 1:245844644-245844666 GCTAACGGCCTGCAGTCTTAGGG + Intronic
1066090102 10:32008877-32008899 CCTAATGTCTTGCAGCCTTTTGG - Intergenic
1073603484 10:104869838-104869860 GCTAGCAGCTTGCAGTCTTTTGG - Intronic
1076533813 10:131163090-131163112 GCTAGTGGCTCTCAGGCTTTGGG + Intronic
1081603552 11:44512341-44512363 GCTAGCTGAATTCAGCCTTTGGG - Intergenic
1087756320 11:102058034-102058056 GCTATCGCTTCTCAGCCTTTTGG + Intronic
1092385540 12:8033364-8033386 GGAATCGGCTTTCAGCCTTCTGG + Exonic
1095650262 12:44599682-44599704 GTTAACCGCTTTCATCGTTTTGG - Intronic
1104597731 12:130131583-130131605 GCCAAGGGCTTTCAGGATTTGGG - Intergenic
1107176955 13:37410364-37410386 GCTAACAGTTCTCAGCCTCTGGG - Intergenic
1111786215 13:92789929-92789951 GCCAAGGGCTGTCAGGCTTTTGG - Intronic
1113248891 13:108429206-108429228 GCTTTCTGCTTCCAGCCTTTGGG + Intergenic
1115194683 14:30783699-30783721 GCTAACTCCTTTCTTCCTTTAGG - Intergenic
1116629038 14:47305729-47305751 GCTAAAGGCTTACAGCCTACTGG + Intronic
1119062195 14:71486334-71486356 GCTCCTGGCTTTCAGCCTTTTGG + Intronic
1128923425 15:71632440-71632462 GCTTTTGGCTTTCAGCCTGTTGG - Intronic
1130398792 15:83529884-83529906 GCAAACAGCTGTCAGGCTTTGGG + Intronic
1130549806 15:84883023-84883045 GCTGGGGGCTTCCAGCCTTTGGG + Intergenic
1143971396 17:10798555-10798577 GCTCAAGGCTGTTAGCCTTTTGG + Intergenic
1147448484 17:40489306-40489328 GGCAACTGCATTCAGCCTTTTGG + Intronic
1148763125 17:50019248-50019270 CCTAACTGCCTGCAGCCTTTGGG - Intergenic
1152390736 17:80002350-80002372 TCTAAGTGCTTTCTGCCTTTAGG - Intronic
1159683177 18:71381151-71381173 GCCAGCGGCTTTCAGGCCTTTGG - Intergenic
1164945800 19:32292143-32292165 GCTAGGGGCTTTGAGCTTTTTGG - Intergenic
925613118 2:5719996-5720018 GCTCCTGGCTTGCAGCCTTTGGG - Intergenic
927936772 2:27080563-27080585 GCTGACAGCTGTCAGCTTTTTGG - Intronic
1175152227 20:56944112-56944134 GCTAACCGCTTTCAGGGTTAAGG - Intergenic
1184864296 22:47193766-47193788 GCTCACGCCTGTCAGCCTTCAGG - Intergenic
1185176654 22:49331256-49331278 CCTAACGGCTGTCAGCCCTTGGG + Intergenic
950908384 3:16560084-16560106 GCTAAGGGCTCTCAGCCCTTGGG + Intergenic
952445257 3:33375335-33375357 GCTACAGGCTCTCTGCCTTTCGG + Exonic
954981546 3:54750540-54750562 GGTATCTGCTTTCAACCTTTGGG - Intronic
960265729 3:115618887-115618909 GCTAACTGATTTCAGACTTCAGG + Intergenic
961098388 3:124176992-124177014 GCTAAGTGCTTTGAGCCCTTGGG - Intronic
961343630 3:126246900-126246922 GCCAACGGAGTTCAGTCTTTGGG + Intergenic
963586236 3:147192619-147192641 CCTAAGGGCTTTAAGGCTTTTGG + Intergenic
965330580 3:167369803-167369825 GCTAAGTCCTTTCATCCTTTAGG - Intronic
968038272 3:195567092-195567114 GCTAACGGCTTTCAGCCTTTTGG + Intergenic
971098408 4:23434821-23434843 GCTCACCGCTTGCACCCTTTGGG - Intergenic
982457154 4:155624048-155624070 GCTCAAGGCTTTCAGCCTGGTGG - Intergenic
987401883 5:17486438-17486460 GGTATCTGTTTTCAGCCTTTTGG - Intergenic
990120269 5:52442652-52442674 GCTAACTGCTTTGAGGCTTGAGG + Intergenic
993220569 5:85090958-85090980 TCAAAAGGCTTTCTGCCTTTTGG - Intergenic
996271744 5:121613827-121613849 CGTATCGCCTTTCAGCCTTTTGG + Intergenic
1005907394 6:30276127-30276149 GCTCACTGCTCTGAGCCTTTTGG - Intergenic
1007495157 6:42254995-42255017 GCTAACCGCTTTTCCCCTTTGGG - Intronic
1009908277 6:69895056-69895078 GCTAACGGGTTTAACTCTTTTGG - Intronic
1024134980 7:46397445-46397467 GCTCACTACTGTCAGCCTTTGGG + Intergenic
1027837885 7:83269233-83269255 GCTAAATGCTTTTAACCTTTAGG - Intergenic
1032234888 7:130112224-130112246 GCTAGCTTCTTTCTGCCTTTGGG + Intronic
1056884939 9:90432887-90432909 GTTAACTGCTTTCAGTCTTAAGG - Intergenic
1189267948 X:39730777-39730799 GCTAACCCCTTCCAGCCTCTGGG - Intergenic
1192545324 X:72008071-72008093 GCTGGAGGCTTTCAGCCTATGGG + Intergenic
1192728800 X:73781427-73781449 GCCAAGGGCTCTCAGGCTTTTGG - Intergenic
1197110136 X:122763213-122763235 GCCAGGGGCTTTCAGGCTTTTGG - Intergenic
1202274668 Y:23103434-23103456 GCTAAGGGCTCTCAGGCCTTCGG + Intergenic
1202291359 Y:23317252-23317274 GCTAAGGGCTCTCAGGCCTTCGG - Intergenic
1202427660 Y:24737170-24737192 GCTAAGGGCTCTCAGGCCTTCGG + Intergenic
1202443131 Y:24932924-24932946 GCTAAGGGCTCTCAGGCCTTCGG - Intergenic