ID: 968038273

View in Genome Browser
Species Human (GRCh38)
Location 3:195567093-195567115
Sequence CTAACGGCTTTCAGCCTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968038263_968038273 11 Left 968038263 3:195567059-195567081 CCTCCATGCCCACCTCCTCCTCA 0: 1
1: 6
2: 19
3: 202
4: 1501
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038259_968038273 19 Left 968038259 3:195567051-195567073 CCCTCCTCCCTCCATGCCCACCT 0: 1
1: 0
2: 24
3: 313
4: 4765
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038265_968038273 3 Left 968038265 3:195567067-195567089 CCCACCTCCTCCTCACTGCCTTT 0: 1
1: 0
2: 8
3: 110
4: 962
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038264_968038273 8 Left 968038264 3:195567062-195567084 CCATGCCCACCTCCTCCTCACTG 0: 1
1: 0
2: 6
3: 156
4: 1215
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038257_968038273 30 Left 968038257 3:195567040-195567062 CCCAGGAGAGGCCCTCCTCCCTC 0: 1
1: 0
2: 5
3: 55
4: 459
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038267_968038273 -1 Left 968038267 3:195567071-195567093 CCTCCTCCTCACTGCCTTTTTGC 0: 1
1: 0
2: 2
3: 69
4: 656
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038266_968038273 2 Left 968038266 3:195567068-195567090 CCACCTCCTCCTCACTGCCTTTT 0: 1
1: 1
2: 15
3: 150
4: 1464
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038262_968038273 12 Left 968038262 3:195567058-195567080 CCCTCCATGCCCACCTCCTCCTC 0: 1
1: 2
2: 17
3: 173
4: 1542
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038258_968038273 29 Left 968038258 3:195567041-195567063 CCAGGAGAGGCCCTCCTCCCTCC 0: 1
1: 0
2: 8
3: 83
4: 492
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038261_968038273 15 Left 968038261 3:195567055-195567077 CCTCCCTCCATGCCCACCTCCTC 0: 1
1: 1
2: 24
3: 207
4: 2016
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038260_968038273 18 Left 968038260 3:195567052-195567074 CCTCCTCCCTCCATGCCCACCTC 0: 1
1: 1
2: 32
3: 262
4: 2086
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038269_968038273 -7 Left 968038269 3:195567077-195567099 CCTCACTGCCTTTTTGCTAACGG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
968038268_968038273 -4 Left 968038268 3:195567074-195567096 CCTCCTCACTGCCTTTTTGCTAA 0: 1
1: 0
2: 0
3: 26
4: 298
Right 968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968038273 Original CRISPR CTAACGGCTTTCAGCCTTTT GGG Intergenic
907026498 1:51125273-51125295 ATAATAGCTTTCAGTCTTTTAGG + Intronic
910928325 1:92418596-92418618 CTAAAGGCCTTCAGCCTCTGGGG - Intergenic
912159909 1:106969138-106969160 CTATCTGCTATCAGCCCTTTTGG + Intergenic
913269420 1:117078491-117078513 CTAAAGGCTTTCAACCTTTAAGG - Intronic
919696047 1:200576725-200576747 ATGATTGCTTTCAGCCTTTTTGG + Intronic
924830411 1:247588393-247588415 CTAGCAGGTTTCATCCTTTTAGG + Exonic
924831946 1:247605610-247605632 CTAATGGATTTCATCCTTCTAGG + Exonic
1071310005 10:84334275-84334297 CTGATGGCTTTCTGCCTCTTTGG + Intronic
1073847070 10:107568654-107568676 CATATGGCTTTCAGCATTTTGGG + Intergenic
1075106027 10:119540631-119540653 AAAACTGCCTTCAGCCTTTTTGG + Intronic
1076355972 10:129853650-129853672 CTGACGGCTTGCAGTCTGTTGGG - Intronic
1087015448 11:93550283-93550305 CTAACTCCTTTCAGAATTTTGGG + Intergenic
1088376209 11:109144581-109144603 CTCAAGGCTCTCAGTCTTTTTGG + Intergenic
1097316317 12:58174616-58174638 ATGAAGGCTTTCAGCCATTTAGG + Intergenic
1097697825 12:62791595-62791617 ATATTGTCTTTCAGCCTTTTAGG - Intronic
1107072770 13:36289722-36289744 ATAACAACTTTCAGCCTTTTAGG - Intronic
1109564147 13:64088708-64088730 CCAACAGCTTTAAGCCTTCTGGG + Intergenic
1109737198 13:66501819-66501841 CTTAAGGCATTAAGCCTTTTGGG + Intronic
1111356484 13:87111545-87111567 CTAATGTCTTTCACTCTTTTGGG + Intergenic
1111366044 13:87246375-87246397 CTCACCTCTTTCAGCCTTTATGG - Intergenic
1115279714 14:31647809-31647831 CTCACTGTTTTCAGCCGTTTTGG + Intronic
1116629039 14:47305730-47305752 CTAAAGGCTTACAGCCTACTGGG + Intronic
1119062196 14:71486335-71486357 CTCCTGGCTTTCAGCCTTTTGGG + Intronic
1120415323 14:84212321-84212343 CTATGGGCTTTCAGTCTTTATGG - Intergenic
1130960485 15:88655559-88655581 CTAGAGGCTTTCGGCTTTTTGGG + Exonic
1140383348 16:74510938-74510960 CTAACTGCTTCTAGCCTTTCAGG - Intronic
1151567208 17:74905411-74905433 TTAATGGTTCTCAGCCTTTTGGG - Intergenic
1160971056 19:1767957-1767979 CCAACGGTTATCAGTCTTTTTGG - Intronic
1163394303 19:17050198-17050220 ATAACGGCTTTCACCCTCTGAGG + Intronic
1164625817 19:29727202-29727224 CTAATGGCTATCAGCCTTGTTGG + Intergenic
926476644 2:13330368-13330390 CCCTCGGTTTTCAGCCTTTTTGG - Intergenic
927037414 2:19193488-19193510 CTCTCTGCTTTCAGCCTTTCTGG - Intergenic
927179039 2:20430960-20430982 CTAATGGCCATTAGCCTTTTTGG - Intergenic
927233206 2:20845594-20845616 CAAATGGCTTTTATCCTTTTTGG + Intergenic
947132317 2:226941328-226941350 CCATCGGCCTTCAGCCTTCTGGG + Intronic
1170395977 20:15926032-15926054 CTAATGACTTACAGCCTTCTGGG - Intronic
1172169231 20:32918811-32918833 CTTTCAGCTTTCAGACTTTTAGG - Intronic
1172384627 20:34525220-34525242 CTAACAACTCTCAGCCTTTGAGG + Intronic
962591470 3:136893924-136893946 CTTTCGGCTTTCATCCTTGTGGG + Intronic
966506279 3:180705776-180705798 CTAAAGGCTTTCAGCCTTCCTGG + Intronic
968038273 3:195567093-195567115 CTAACGGCTTTCAGCCTTTTGGG + Intergenic
970806523 4:20042197-20042219 CTAAGTGCTTCCTGCCTTTTAGG + Intergenic
979833753 4:125334489-125334511 CTAATGGCATTTAACCTTTTAGG + Intronic
980414640 4:132469599-132469621 ATAAGGGCTTTCATCCTTGTTGG + Intergenic
982200300 4:152953971-152953993 GTTGCTGCTTTCAGCCTTTTTGG + Intronic
983009563 4:162529960-162529982 ATAATGGCTTTGAGCCATTTTGG + Intergenic
983077863 4:163347391-163347413 ACAACGGCTTTGTGCCTTTTTGG - Intronic
994365759 5:98915060-98915082 GCAACGGCTTTCAAACTTTTTGG + Intronic
995261055 5:110104866-110104888 CTAACGGGTTTCACACTTCTTGG + Intergenic
995911248 5:117189675-117189697 AAAATGGCTTTCAGTCTTTTTGG + Intergenic
997700281 5:135893119-135893141 CTCAGGGCTTTCAGCCTTCTAGG + Intronic
999985912 5:157005201-157005223 CTAATGGCTCTCTTCCTTTTTGG - Intergenic
1000456410 5:161454996-161455018 CTAACAGTTTTCATCCTTATTGG - Intronic
1002968974 6:1995077-1995099 CTTACGGCTTGCAGGTTTTTAGG - Intronic
1011048482 6:83115073-83115095 CTAACAACTATCATCCTTTTGGG - Intronic
1012972245 6:105743790-105743812 ATAACGGCTCTCAGCCCATTTGG + Intergenic
1014465596 6:121752835-121752857 CAAAAAGATTTCAGCCTTTTAGG + Intergenic
1014975410 6:127875402-127875424 CTAATGGCTTTCTGCAGTTTGGG - Intronic
1015151135 6:130039516-130039538 GTATTGGCTTTCAGACTTTTTGG + Intronic
1020922812 7:14285839-14285861 CTAATGGCAGTCAGCATTTTTGG + Intronic
1023502717 7:40867415-40867437 CTAACGTTTTTCAGAATTTTTGG - Intergenic
1023791172 7:43754936-43754958 CTACAGGCTTCCAGCCATTTGGG - Intergenic
1033397124 7:140985867-140985889 CTACTGGCTTTCATTCTTTTAGG - Intergenic
1035684010 8:1509482-1509504 CCAAGGGCTTTCAAACTTTTTGG - Intronic
1038926838 8:32150200-32150222 CAGAAGGCTTTCAACCTTTTGGG - Intronic
1039033386 8:33333171-33333193 CTCAGGCCTTTCAGCCTTCTGGG - Intergenic
1039291202 8:36095952-36095974 CTAAAGCCTTTCAGCCTCTCTGG - Intergenic
1046642975 8:116753196-116753218 CTAACAACTTTCCCCCTTTTTGG - Intronic
1053592647 9:39529979-39530001 ATCAGGGCTTTAAGCCTTTTAGG + Intergenic
1053621428 9:39823105-39823127 CTAAAGTCTTTCAGAATTTTAGG + Intergenic
1053850381 9:42284700-42284722 ATCAGGGCTTTAAGCCTTTTAGG + Intergenic
1054262735 9:62884332-62884354 CTAAAGTCTTTCAGAATTTTAGG - Intergenic
1054573655 9:66835297-66835319 ATCAGGGCTTTAAGCCTTTTAGG - Intergenic
1059910328 9:119036503-119036525 CTGAGGGCTTTCTGCCTCTTTGG + Intergenic
1060628142 9:125131997-125132019 CAAACTGCTTTCTGTCTTTTGGG - Intronic
1187055578 X:15738587-15738609 CAAACGGCTGTCATCCTTTAAGG + Intronic
1189820304 X:44864263-44864285 CTAAAGGCTATTAGCCTTTCAGG - Intergenic
1193294919 X:79822610-79822632 CTAACAGCTGTCATGCTTTTAGG - Intergenic
1194251984 X:91587368-91587390 CTCACTGTTTTCATCCTTTTTGG - Intergenic
1200570916 Y:4828606-4828628 CTCACTGTTTTCATCCTTTTTGG - Intergenic