ID: 968039747

View in Genome Browser
Species Human (GRCh38)
Location 3:195579068-195579090
Sequence GCGTTCCTGAGCTGTCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968039747 Original CRISPR GCGTTCCTGAGCTGTCGCCC TGG (reversed) Intronic
902785544 1:18730659-18730681 CCGTTCCTGAGCTGGCCCCGAGG - Intronic
902912116 1:19606718-19606740 GCCTTCTTGTTCTGTCGCCCAGG - Intronic
905363477 1:37435985-37436007 GCGGCCCTGAGCTGCCTCCCAGG + Intergenic
907017283 1:51029446-51029468 GGGTTCTTGATCTGTTGCCCAGG + Intergenic
909785578 1:79607933-79607955 GCCTTCTTGCTCTGTCGCCCAGG + Intergenic
912454071 1:109786215-109786237 GGGTTCCTGATTTGGCGCCCAGG + Intergenic
916170203 1:161996111-161996133 GCGTTCATGAGATTTTGCCCTGG + Intronic
918806700 1:189055832-189055854 GGGTTCTTGCTCTGTCGCCCAGG - Intergenic
1062925679 10:1314042-1314064 GGGCTCCTGAGCTGTGGCACGGG - Intronic
1062959592 10:1562501-1562523 GCAGTCATGAGCTGTCTCCCTGG + Intronic
1070280374 10:75043999-75044021 GCGGTCCAGCGCCGTCGCCCTGG + Exonic
1073056580 10:100707048-100707070 GCTTTCCCGAGCCGTCTCCCTGG + Intergenic
1075877333 10:125819008-125819030 GCAGTCCTGCTCTGTCGCCCAGG + Intronic
1077159099 11:1104561-1104583 CTGTCCCTGAGCTGTCCCCCTGG + Intergenic
1084615724 11:70234561-70234583 GGGGTCCTGCTCTGTCGCCCAGG + Intergenic
1085102421 11:73812687-73812709 GGGATCCTGCTCTGTCGCCCAGG - Intronic
1086427354 11:86698851-86698873 GCATTCCTGACCTGACTCCCAGG - Intergenic
1088470389 11:110183351-110183373 GCGTTCTTGCTCTGTCACCCAGG + Intronic
1097183162 12:57182485-57182507 GGAGTCCTGATCTGTCGCCCAGG - Intronic
1098279140 12:68845787-68845809 GCGGTCTTGCTCTGTCGCCCAGG + Exonic
1103807294 12:123583509-123583531 GGGGTCTTGATCTGTCGCCCAGG - Intergenic
1107448101 13:40486019-40486041 GGGTACCTGAGCTGCTGCCCCGG - Intergenic
1110708810 13:78627038-78627060 TCTTTCCTGTGCTGTCGCCCAGG - Intronic
1111302646 13:86365666-86365688 GCTCTCCTGAGCTGTGGCCTAGG - Intergenic
1113473111 13:110561062-110561084 GCGTTCCTGCTCTGCCGCCCTGG - Intronic
1114448402 14:22807538-22807560 GGGTTCTTGCTCTGTCGCCCAGG - Intronic
1127347445 15:58114617-58114639 GAGTTCCTGCTCTGTCACCCAGG - Intronic
1129606540 15:77027974-77027996 GCGATCCTGGGCTGTGGCCCCGG + Intronic
1132721207 16:1316810-1316832 GCTTTACTGAGCTGTTGTCCTGG - Intronic
1132930176 16:2455032-2455054 GTGTTCTTGCTCTGTCGCCCAGG - Intronic
1133209614 16:4256226-4256248 GGGGTCCTGCTCTGTCGCCCAGG - Intergenic
1134155995 16:11843843-11843865 GAGTTCTTGCTCTGTCGCCCAGG - Intronic
1136323345 16:29502341-29502363 TCGTTCCAGAGCTGGCGCCTTGG + Intronic
1136438030 16:30242310-30242332 TCGTTCCAGAGCTGGCGCCTTGG + Intronic
1145766325 17:27460593-27460615 GCTTTCCTGAGCAGTTGCCCTGG + Intronic
1147934653 17:44004796-44004818 GCGGTGCTGAGCCGGCGCCCCGG - Exonic
1148871014 17:50658867-50658889 GGGTTAATGAGCTGTCACCCAGG - Intronic
1150066689 17:62115940-62115962 AAGTTCCTGCTCTGTCGCCCAGG - Intergenic
1155656615 18:28200664-28200686 GAGTTCTTGCTCTGTCGCCCAGG - Intergenic
1157890621 18:51413085-51413107 GGAGTCCTGATCTGTCGCCCAGG + Intergenic
1157915360 18:51658993-51659015 GCGTTTCTGAGCAGGTGCCCAGG - Intergenic
1162395595 19:10416705-10416727 CCGTGCGTCAGCTGTCGCCCTGG + Intronic
1163700468 19:18784320-18784342 GCGTTCCGCAGCTGTTCCCCGGG + Exonic
1168119490 19:54243601-54243623 AGGATCCTGCGCTGTCGCCCAGG - Intronic
926126197 2:10273415-10273437 GCCTTCCTGAGCTTCCACCCCGG + Intergenic
930189160 2:48440648-48440670 GCGTGCCTGGGCTGTGCCCCTGG - Intronic
930599625 2:53428100-53428122 GGGATCCTGCTCTGTCGCCCAGG - Intergenic
933063826 2:77769837-77769859 GAGTTCCTGCTCTGTCACCCAGG - Intergenic
938870797 2:135474163-135474185 GGGGTCCTGATCTGTCTCCCAGG - Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948860437 2:240750230-240750252 GCTGTCCTGGGCTGGCGCCCCGG - Intronic
949049811 2:241891462-241891484 GCGTTCGTGAGGTGAGGCCCAGG - Intergenic
949083847 2:242130273-242130295 GGGGTCCTGCTCTGTCGCCCAGG - Intergenic
1171025356 20:21625098-21625120 GCTTTCCTGACCTGGCTCCCAGG + Intergenic
1176294618 21:5064776-5064798 GAGGTCCTGACCTGCCGCCCAGG - Intergenic
1180119097 21:45734623-45734645 CCCTTCCTGTGCTGTGGCCCAGG + Intronic
1183422829 22:37722214-37722236 GCTTTCTAGAGCTGTCGCACAGG + Intronic
1184176489 22:42792253-42792275 GCCATCCTGAGCTGGCTCCCAGG + Intergenic
1184471069 22:44696760-44696782 GCAGTCCTGCTCTGTCGCCCAGG + Intronic
1184499407 22:44862753-44862775 TGGTTCCTGAGCTGTGGACCGGG + Exonic
950514077 3:13452691-13452713 GCGGTCTTGCTCTGTCGCCCAGG + Intergenic
960387305 3:117035720-117035742 ACATTCCTGAGCTGTCATCCTGG - Intronic
965452220 3:168852352-168852374 GAGTTCTTGCTCTGTCGCCCAGG + Intergenic
968039747 3:195579068-195579090 GCGTTCCTGAGCTGTCGCCCTGG - Intronic
970192465 4:13529279-13529301 GCGAAGCTGTGCTGTCGCCCAGG - Intergenic
972095712 4:35344394-35344416 GCGTTCTTGCTATGTCGCCCAGG - Intergenic
972636513 4:40889023-40889045 GCTTGCCAGAGCTGTAGCCCTGG - Intronic
972745788 4:41931261-41931283 ACAGTCTTGAGCTGTCGCCCAGG - Intergenic
974000532 4:56506716-56506738 GAGTTCCTGAGCTGGCTCCTTGG + Intronic
982222681 4:153138264-153138286 GCCAGCCTGAGCTGTCTCCCAGG - Intergenic
985725710 5:1514877-1514899 GCCCTCCGGAGCTGTGGCCCAGG + Intronic
986202685 5:5592321-5592343 GCGTTCCTGGGCTGCGGTCCTGG - Intergenic
990253899 5:53945009-53945031 GCCTCCCTGATCTGTTGCCCAGG - Intronic
992955593 5:81905031-81905053 TCTTTCCTGCTCTGTCGCCCAGG - Intergenic
996898300 5:128512485-128512507 GGGTTCCTGCTCTGTTGCCCAGG - Intronic
996997719 5:129718934-129718956 GCCTTCCTTAGCTGTTGGCCTGG + Intronic
997310377 5:132874852-132874874 AAGTTCCTAAGCTGTGGCCCTGG + Exonic
997449458 5:133969923-133969945 GTGTTTCTGAGCTGTCACCAGGG - Intergenic
997552492 5:134765525-134765547 GGAGTCCTGATCTGTCGCCCAGG - Intronic
1004245072 6:13966735-13966757 AGGTTCCTGATCTGTCGCCCAGG - Intronic
1006613137 6:35307371-35307393 GCGTTCCAAATCTGCCGCCCAGG - Intronic
1011043730 6:83059356-83059378 AGGTTCTTGATCTGTCGCCCAGG - Intronic
1012245852 6:96924748-96924770 GCGCTCCCGAACTGTCGCGCGGG - Exonic
1012893439 6:104922565-104922587 AGGGTCCTGCGCTGTCGCCCAGG + Intergenic
1019180441 6:170184287-170184309 GTGTTCCTTGGCTGTCGCCGTGG - Intergenic
1020978675 7:15040058-15040080 GTATTCCTGCTCTGTCGCCCAGG - Intergenic
1021606648 7:22415078-22415100 GGGTTCCTGAGCTGGACCCCAGG - Intergenic
1024240752 7:47433715-47433737 GCATTCCTGAGCTGTGAGCCTGG - Intronic
1025978002 7:66384831-66384853 ACGGTCCTGCTCTGTCGCCCAGG + Intronic
1034153836 7:148938231-148938253 GCGTTCTTGCTCTGTCACCCAGG + Intergenic
1039695538 8:39906103-39906125 GCAGTCTTGCGCTGTCGCCCAGG - Intronic
1040551753 8:48443262-48443284 GCGTTGCGGTGCTGTTGCCCAGG - Intergenic
1044990765 8:97793830-97793852 GGGTTCTTGCTCTGTCGCCCAGG + Intronic
1046648674 8:116813140-116813162 GCGGTCTTGCTCTGTCGCCCAGG - Intronic
1049743547 8:144252640-144252662 GAGTTCTTGCTCTGTCGCCCAGG - Intronic
1062022284 9:134325383-134325405 GCCTTCCTGAGCAGGCGCCGAGG - Intronic
1189304710 X:39978254-39978276 GCCTTCCTGTGATGTGGCCCCGG + Intergenic
1190699527 X:52976416-52976438 GGAGTCCTGATCTGTCGCCCGGG - Intronic
1193627264 X:83836885-83836907 GTCTTCTTGCGCTGTCGCCCAGG - Intergenic
1200046892 X:153408008-153408030 ACTGTCCTGAGCTGTCACCCAGG - Intergenic