ID: 968039859

View in Genome Browser
Species Human (GRCh38)
Location 3:195579753-195579775
Sequence TGGGAGATGCATAATTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968039859_968039867 18 Left 968039859 3:195579753-195579775 CCCACCTAATTATGCATCTCCCA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 968039867 3:195579794-195579816 GTTCTCCTCAGAATCACCCACGG 0: 1
1: 0
2: 2
3: 17
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968039859 Original CRISPR TGGGAGATGCATAATTAGGT GGG (reversed) Intronic
902479214 1:16702790-16702812 TGGGAGATGGGTAGCTAGGTGGG + Intergenic
904098814 1:28004501-28004523 TGGGAAATTCATAAATATGTAGG + Intronic
907258020 1:53195045-53195067 TGGGAGCTGGAGAAGTAGGTAGG + Intergenic
907331339 1:53673556-53673578 TGGGAGATGCATGAGAAGCTCGG - Intronic
907845470 1:58201950-58201972 TGATAGAAGCAGAATTAGGTAGG - Intronic
910903888 1:92152711-92152733 TGGGAGAGGCATAGTTTGATGGG - Intergenic
911881858 1:103250200-103250222 TGGCAGGAGCATAATTAAGTAGG + Intergenic
912106021 1:106276664-106276686 TGGGAGGTGGATAAGTAGGTGGG - Intergenic
914859632 1:151375201-151375223 GGGGTGATGCAGCATTAGGTGGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917944137 1:179952193-179952215 AGGGAGATGGAAAGTTAGGTTGG + Intergenic
918731437 1:188002075-188002097 TGGTTGATGGACAATTAGGTTGG + Intergenic
920061938 1:203232947-203232969 TGGGACCTGCCTACTTAGGTGGG - Intronic
922455616 1:225771362-225771384 TGGGGGATGCCTTAGTAGGTAGG + Intergenic
1065141676 10:22724507-22724529 TGAGGGGTGCATAATTAAGTAGG + Intergenic
1065177620 10:23095227-23095249 TGGGAGATGCAGAGATGGGTTGG + Intergenic
1070298063 10:75181859-75181881 TGGGGGAAGCAAAATTAGCTGGG + Exonic
1071505802 10:86230834-86230856 TGGGAGATGGATAGATGGGTTGG - Intronic
1072502367 10:96030502-96030524 TGGGAGTTGAGTACTTAGGTGGG + Intronic
1073161575 10:101402099-101402121 TGGTAAATTCATAATTAGGAAGG + Intronic
1080577152 11:33610263-33610285 TGGAAGTTGCACCATTAGGTAGG - Intronic
1082923282 11:58519004-58519026 TGGGATTTGCATAATTCAGTAGG - Intergenic
1084799034 11:71529163-71529185 AAGCAAATGCATAATTAGGTTGG + Intronic
1088067679 11:105740986-105741008 TGAGAGGAGCATAATTAGGGAGG + Intronic
1091519120 12:1218290-1218312 AGGGAGAAGCATCTTTAGGTTGG - Intronic
1093718961 12:22415527-22415549 GGTGAGATGCATCATTATGTTGG - Intronic
1096103761 12:48984953-48984975 TGGGAAGTGCAGAATTAGGCTGG + Intergenic
1100911084 12:99364407-99364429 TGGGAGATGCGGAAGTAGTTAGG - Intronic
1101046452 12:100811130-100811152 TGGGAGAGGAATAATTTGGGCGG + Intronic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1103127186 12:118433912-118433934 TGAGAAATGCATTGTTAGGTTGG + Intergenic
1104799114 12:131541342-131541364 TGTGAGATGCCTAACAAGGTTGG + Intergenic
1111634581 13:90887545-90887567 TGGAATCTCCATAATTAGGTAGG - Intergenic
1111926475 13:94468741-94468763 TTAGAGATACATTATTAGGTGGG - Exonic
1113524886 13:110966983-110967005 TTGGAGAGGGATATTTAGGTTGG - Intergenic
1115167979 14:30471144-30471166 TGGGTGATGAATAATTTGGTTGG - Intergenic
1117996538 14:61483321-61483343 GGGGAGAGGCAGAATTGGGTGGG - Intronic
1120419872 14:84270548-84270570 TGGGAGATGTATAATAAAATTGG + Intergenic
1120559721 14:85975311-85975333 TGGTAGATGAATATTTTGGTAGG - Intergenic
1125900082 15:43337855-43337877 TGAGAAATTTATAATTAGGTTGG + Intronic
1129582621 15:76829050-76829072 TGGTTGATGGATATTTAGGTTGG - Intronic
1134157716 16:11857141-11857163 TGTAAGATGCAAAATTAGGCTGG - Intergenic
1140726848 16:77821237-77821259 TGGGATCTGCATAATTATGAAGG + Intronic
1141871804 16:86791678-86791700 TAAAAGATGCATAATTAGGATGG + Intergenic
1142152672 16:88519614-88519636 GGGTGGATGCATGATTAGGTGGG + Intronic
1143264131 17:5623008-5623030 GGGCAGATGGATAAATAGGTAGG - Intergenic
1145354346 17:22126118-22126140 TTGCATATGCATATTTAGGTTGG + Intergenic
1145895047 17:28451771-28451793 TGGGATATGCAGAACTGGGTAGG - Intergenic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1147142147 17:38466016-38466038 AGGGAGAGGCATAAGTGGGTGGG - Intronic
1148264465 17:46214289-46214311 TGGGACATGCATCTTTAGGAGGG - Intronic
1150995900 17:70317152-70317174 TGGAAGATGCAAAATGAGGTTGG - Intergenic
1151047460 17:70938152-70938174 TGGGAGATGTAGCATTTGGTTGG - Intergenic
1152365492 17:79854009-79854031 TGAGAGATGTTTAATTAGGCAGG + Intergenic
1152587965 17:81197516-81197538 GGGGTGCTGCATAACTAGGTGGG + Intronic
1153654231 18:7268262-7268284 TGTGAGACACATAATTTGGTAGG + Intergenic
1157350237 18:46877605-46877627 TTGAATATGAATAATTAGGTAGG - Intronic
1158937522 18:62378074-62378096 TGGCAGCTGTATAATCAGGTGGG - Intronic
1159916219 18:74190262-74190284 TGGGAAATACACAATTATGTAGG - Intergenic
1164104150 19:22090852-22090874 TGAGAGATACTTTATTAGGTGGG + Exonic
1164400651 19:27900022-27900044 TGGTAGATGGATAAATTGGTGGG - Intergenic
1202713253 1_KI270714v1_random:28696-28718 TGGGAGATGGGTAGCTAGGTGGG + Intergenic
926400258 2:12489411-12489433 TGGCAGATGCACAAGCAGGTAGG - Intergenic
929041134 2:37745867-37745889 TTTGAGATGCATAATTTAGTTGG + Intergenic
929554590 2:42917762-42917784 TCGAAGATGAATAATGAGGTAGG + Intergenic
930576237 2:53152652-53152674 TCAGAGATGTTTAATTAGGTAGG - Intergenic
936474166 2:112825002-112825024 TGGGAAATGAAGAATGAGGTGGG + Intergenic
937384383 2:121414444-121414466 TGGTTGATGCATACTTAGTTTGG - Intronic
937488720 2:122342747-122342769 TTTGAGATGCATAATTAACTAGG + Intergenic
938099519 2:128489320-128489342 TGAGAGATGGATAATCAGGATGG + Intergenic
940070772 2:149685013-149685035 TGTGAGATGGATAATTATTTAGG + Intergenic
940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG + Intergenic
943390582 2:187262491-187262513 AGGGAGATTCATAATAAGTTCGG + Intergenic
945427914 2:209730109-209730131 TGGGAGATGGAGAAAGAGGTAGG + Intronic
946007572 2:216538722-216538744 TGGGAGAGGCGTCATTAGGATGG - Intronic
947025588 2:225734383-225734405 TGGTAGATAGATAAATAGGTAGG - Intergenic
947450219 2:230201082-230201104 TGGTAGATGCATTGTTAGGAGGG - Intronic
1172518040 20:35549267-35549289 TGGGAGAAGCAGAGCTAGGTTGG + Intronic
1173702999 20:45089616-45089638 TGGTAGGTGCAAAATTAGATGGG + Intergenic
1174835350 20:53851752-53851774 TGGGTAATCCATATTTAGGTAGG + Intergenic
1180848259 22:18996217-18996239 TAAGAAATGCATAATAAGGTGGG + Intergenic
1203293403 22_KI270736v1_random:17437-17459 TTTGAGATGCATAATTTAGTTGG + Intergenic
949252474 3:2003462-2003484 CAGAAAATGCATAATTAGGTAGG + Intergenic
951265074 3:20555452-20555474 AGGTAGATAGATAATTAGGTAGG + Intergenic
955401034 3:58591734-58591756 TGAAAGAGTCATAATTAGGTGGG - Intronic
959246409 3:103875304-103875326 AGAGAGATGCAGAATTACGTGGG + Intergenic
959901962 3:111671513-111671535 TGGGAGAGGCATATGTAGCTGGG - Intergenic
961132578 3:124482848-124482870 TTGGACAGGCTTAATTAGGTAGG - Exonic
963089883 3:141473885-141473907 CTTGAGATGCATCATTAGGTTGG + Intergenic
963559348 3:146842290-146842312 TCTGGGATGCATAATTAGATGGG + Intergenic
963618010 3:147568169-147568191 TGGATGATGGATACTTAGGTTGG - Intergenic
963757068 3:149246091-149246113 TGGGAGATACAGAATTACGGTGG - Intergenic
965943109 3:174209218-174209240 TAGGAAATACAGAATTAGGTCGG - Intronic
966110079 3:176390519-176390541 TGGCAGATGGATATGTAGGTTGG - Intergenic
966361541 3:179135341-179135363 TGGTAGATAGATACTTAGGTTGG - Intergenic
967404984 3:189105408-189105430 TGGGAGATGTCTAATATGGTAGG - Intronic
967442722 3:189527647-189527669 AGGCAGATGCATAATGAGGTGGG - Intergenic
968039859 3:195579753-195579775 TGGGAGATGCATAATTAGGTGGG - Intronic
971961542 4:33493910-33493932 TGGGGGATTAATAATTAGGATGG - Intergenic
974160633 4:58133549-58133571 TTAGAGATTCATAATTAGATGGG - Intergenic
975528180 4:75373878-75373900 TGGGAGCTGCATTGTTAGGCTGG - Intergenic
976136302 4:81940143-81940165 TTTGAGGTGCGTAATTAGGTTGG - Intronic
978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG + Intergenic
979551446 4:121995774-121995796 TTTGAGATGTATAATTAAGTTGG + Intergenic
981568089 4:146122192-146122214 TGGAAGATGAACTATTAGGTTGG + Intergenic
982146045 4:152393760-152393782 TAGGAGATGCATTACTTGGTTGG - Intronic
982356180 4:154471876-154471898 AAGGTGATGCATAGTTAGGTCGG + Intronic
984581904 4:181519567-181519589 TTTGAGAGGCATAATTATGTTGG + Intergenic
989006704 5:36822443-36822465 TGGTTGATGGATATTTAGGTTGG + Intergenic
989526291 5:42456997-42457019 TGGGAGCTGGATCATTAGTTGGG + Intronic
994562998 5:101400848-101400870 TGAGAGATACATGAGTAGGTGGG + Intergenic
995920804 5:117308895-117308917 TGGGAGATAGATTATGAGGTTGG + Intergenic
996362752 5:122668856-122668878 TGGCAGATGAAAAATTAGTTTGG + Intergenic
999573304 5:152945163-152945185 TGGGACTTGAATAATTTGGTGGG - Intergenic
999594790 5:153191019-153191041 TGAGAGATGAATAATTACGTTGG - Intergenic
1003160840 6:3633135-3633157 TGTGCAATGAATAATTAGGTTGG + Intergenic
1003343227 6:5241946-5241968 TGGGAGTTTCTTATTTAGGTTGG - Intronic
1003823052 6:9922053-9922075 TGGTATATGCATGATTAGTTGGG - Intronic
1004989361 6:21119691-21119713 GGGGAAATGCAAAAGTAGGTGGG - Intronic
1008429383 6:51398040-51398062 TGGGAGTTGGAAAAATAGGTAGG - Intergenic
1010710488 6:79169052-79169074 AGGGATTTGCATAATTAGATTGG + Intergenic
1011827656 6:91329416-91329438 TGTGAGATGCATTTGTAGGTGGG + Intergenic
1012362610 6:98402149-98402171 AGGGAGATAAATAAGTAGGTAGG - Intergenic
1020406777 7:7844409-7844431 TAGCAGAGGCATAACTAGGTAGG - Intronic
1023509959 7:40941740-40941762 TGGGAGCTCCAGAGTTAGGTGGG + Intergenic
1023887725 7:44373268-44373290 TAGGAGATGCATTAGTAGGGAGG - Intergenic
1024653828 7:51432269-51432291 TGGGAAATGCTTAGGTAGGTTGG - Intergenic
1024871247 7:53963711-53963733 TGGGAAATGCAATCTTAGGTAGG + Intergenic
1032277199 7:130468568-130468590 TGGGAGATGGGCAATTAAGTAGG - Intergenic
1036948552 8:13119295-13119317 AGGGAGCTGAACAATTAGGTTGG - Intronic
1037103038 8:15071736-15071758 TGGGAGTAGCATAATCAGATGGG + Intronic
1038326779 8:26577809-26577831 TGGGATATGCAAATTTAGGCCGG - Intronic
1038949329 8:32397082-32397104 TAGGAGATGGATAAATAGGTAGG + Intronic
1040639119 8:49311249-49311271 TGGAAGATGCACAATGAGCTTGG + Intergenic
1044378098 8:91500002-91500024 TGGGAAAAGCATAATTATCTGGG + Intergenic
1046674054 8:117089350-117089372 TGGGAGATGCAAAATTCAGCTGG - Intronic
1047822139 8:128532627-128532649 TGGGTAATGCATACTCAGGTAGG - Intergenic
1051611838 9:18968910-18968932 TTAGAGAAGCATAATAAGGTAGG + Intronic
1054744536 9:68841342-68841364 TGGGAGATGCATAATAATCCAGG - Intronic
1055113970 9:72587586-72587608 TGGAAGATGCATTTTTATGTGGG + Intronic
1057612258 9:96555456-96555478 TGGGAGTTGCTTAACTTGGTTGG - Intronic
1060020576 9:120127194-120127216 TGGAAGAGGTAGAATTAGGTTGG + Intergenic
1062024745 9:134335147-134335169 TGAGAGGTGCCTAATGAGGTGGG - Intronic
1185876320 X:3705184-3705206 TGGGAGATTCAGAGTTTGGTGGG + Intronic
1187737414 X:22319207-22319229 TGGGAGATAGATAGGTAGGTAGG - Intergenic
1191093966 X:56655295-56655317 TGAGAGAAGCATAATTACCTGGG + Intergenic
1193596946 X:83458517-83458539 TGGTTGATGGACAATTAGGTTGG - Intergenic
1196893546 X:120311602-120311624 TGGGAGGTGGATAACTAGGATGG - Intergenic
1197508471 X:127339547-127339569 TTTAAGATGCATCATTAGGTTGG + Intergenic
1197549009 X:127864807-127864829 TGGGTGATGGACACTTAGGTTGG - Intergenic
1197556375 X:127959927-127959949 TGGGTGATGGACATTTAGGTTGG + Intergenic
1198465644 X:136902474-136902496 TGGGAGAAGCATATTTAGATTGG + Intergenic
1200324102 X:155219671-155219693 TGGGAAATGCATAAAGTGGTGGG + Intronic