ID: 968041419

View in Genome Browser
Species Human (GRCh38)
Location 3:195592257-195592279
Sequence GAGAGAAAGGAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968041413_968041419 -7 Left 968041413 3:195592241-195592263 CCATGTGCTGCCTCGAGAGAGAA No data
Right 968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG No data
968041412_968041419 11 Left 968041412 3:195592223-195592245 CCTGAGATGTCTTGGAAGCCATG No data
Right 968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968041419 Original CRISPR GAGAGAAAGGAGAAGGAGGG AGG Intergenic
No off target data available for this crispr