ID: 968044467

View in Genome Browser
Species Human (GRCh38)
Location 3:195616322-195616344
Sequence TCCCGTTAGCTCCACCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968044462_968044467 17 Left 968044462 3:195616282-195616304 CCTGCCTGTGCTCACCGTGGCCT No data
Right 968044467 3:195616322-195616344 TCCCGTTAGCTCCACCTTACAGG No data
968044460_968044467 20 Left 968044460 3:195616279-195616301 CCTCCTGCCTGTGCTCACCGTGG No data
Right 968044467 3:195616322-195616344 TCCCGTTAGCTCCACCTTACAGG No data
968044457_968044467 28 Left 968044457 3:195616271-195616293 CCCCGTGGCCTCCTGCCTGTGCT No data
Right 968044467 3:195616322-195616344 TCCCGTTAGCTCCACCTTACAGG No data
968044464_968044467 13 Left 968044464 3:195616286-195616308 CCTGTGCTCACCGTGGCCTGGTC No data
Right 968044467 3:195616322-195616344 TCCCGTTAGCTCCACCTTACAGG No data
968044466_968044467 -3 Left 968044466 3:195616302-195616324 CCTGGTCTGCGCTGCACGTGTCC No data
Right 968044467 3:195616322-195616344 TCCCGTTAGCTCCACCTTACAGG No data
968044459_968044467 26 Left 968044459 3:195616273-195616295 CCGTGGCCTCCTGCCTGTGCTCA No data
Right 968044467 3:195616322-195616344 TCCCGTTAGCTCCACCTTACAGG No data
968044465_968044467 3 Left 968044465 3:195616296-195616318 CCGTGGCCTGGTCTGCGCTGCAC No data
Right 968044467 3:195616322-195616344 TCCCGTTAGCTCCACCTTACAGG No data
968044458_968044467 27 Left 968044458 3:195616272-195616294 CCCGTGGCCTCCTGCCTGTGCTC No data
Right 968044467 3:195616322-195616344 TCCCGTTAGCTCCACCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968044467 Original CRISPR TCCCGTTAGCTCCACCTTAC AGG Intergenic
No off target data available for this crispr