ID: 968045143

View in Genome Browser
Species Human (GRCh38)
Location 3:195619767-195619789
Sequence CTTTCTATGGTGCTGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968045143_968045157 28 Left 968045143 3:195619767-195619789 CCCACCAACAGCACCATAGAAAG No data
Right 968045157 3:195619818-195619840 CTCAGTGGAGCTCTGGCCACAGG No data
968045143_968045148 -4 Left 968045143 3:195619767-195619789 CCCACCAACAGCACCATAGAAAG No data
Right 968045148 3:195619786-195619808 AAAGAGAAGTGACAGCACCCGGG No data
968045143_968045147 -5 Left 968045143 3:195619767-195619789 CCCACCAACAGCACCATAGAAAG No data
Right 968045147 3:195619785-195619807 GAAAGAGAAGTGACAGCACCCGG No data
968045143_968045158 29 Left 968045143 3:195619767-195619789 CCCACCAACAGCACCATAGAAAG No data
Right 968045158 3:195619819-195619841 TCAGTGGAGCTCTGGCCACAGGG No data
968045143_968045154 21 Left 968045143 3:195619767-195619789 CCCACCAACAGCACCATAGAAAG No data
Right 968045154 3:195619811-195619833 CACGACCCTCAGTGGAGCTCTGG No data
968045143_968045151 13 Left 968045143 3:195619767-195619789 CCCACCAACAGCACCATAGAAAG No data
Right 968045151 3:195619803-195619825 CCCGGGGCCACGACCCTCAGTGG No data
968045143_968045149 -3 Left 968045143 3:195619767-195619789 CCCACCAACAGCACCATAGAAAG No data
Right 968045149 3:195619787-195619809 AAGAGAAGTGACAGCACCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968045143 Original CRISPR CTTTCTATGGTGCTGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr