ID: 968046163

View in Genome Browser
Species Human (GRCh38)
Location 3:195624866-195624888
Sequence AGGAGCCGCTGTGCGCGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968046151_968046163 17 Left 968046151 3:195624826-195624848 CCGGCCCGAGGACGCGGGCGCGG No data
Right 968046163 3:195624866-195624888 AGGAGCCGCTGTGCGCGTTCAGG No data
968046155_968046163 13 Left 968046155 3:195624830-195624852 CCCGAGGACGCGGGCGCGGGGCG No data
Right 968046163 3:195624866-195624888 AGGAGCCGCTGTGCGCGTTCAGG No data
968046156_968046163 12 Left 968046156 3:195624831-195624853 CCGAGGACGCGGGCGCGGGGCGG No data
Right 968046163 3:195624866-195624888 AGGAGCCGCTGTGCGCGTTCAGG No data
968046147_968046163 30 Left 968046147 3:195624813-195624835 CCAGGGGGCGCTGCCGGCCCGAG No data
Right 968046163 3:195624866-195624888 AGGAGCCGCTGTGCGCGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968046163 Original CRISPR AGGAGCCGCTGTGCGCGTTC AGG Intergenic
No off target data available for this crispr