ID: 968048195

View in Genome Browser
Species Human (GRCh38)
Location 3:195635531-195635553
Sequence GGGGGAGACCGCGGGGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968048195_968048206 -1 Left 968048195 3:195635531-195635553 CCGGGTCCCCCGCGGTCTCCCCC No data
Right 968048206 3:195635553-195635575 CGTCCGCTGCCCGGTCTCCTGGG No data
968048195_968048205 -2 Left 968048195 3:195635531-195635553 CCGGGTCCCCCGCGGTCTCCCCC No data
Right 968048205 3:195635552-195635574 CCGTCCGCTGCCCGGTCTCCTGG No data
968048195_968048207 0 Left 968048195 3:195635531-195635553 CCGGGTCCCCCGCGGTCTCCCCC No data
Right 968048207 3:195635554-195635576 GTCCGCTGCCCGGTCTCCTGGGG No data
968048195_968048200 -10 Left 968048195 3:195635531-195635553 CCGGGTCCCCCGCGGTCTCCCCC No data
Right 968048200 3:195635544-195635566 GGTCTCCCCCGTCCGCTGCCCGG No data
968048195_968048212 21 Left 968048195 3:195635531-195635553 CCGGGTCCCCCGCGGTCTCCCCC No data
Right 968048212 3:195635575-195635597 GGCCGCCCCTGCCTCCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968048195 Original CRISPR GGGGGAGACCGCGGGGGACC CGG (reversed) Intergenic
No off target data available for this crispr