ID: 968054409

View in Genome Browser
Species Human (GRCh38)
Location 3:195680558-195680580
Sequence ACTTAGGTATGCTGGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054409_968054417 29 Left 968054409 3:195680558-195680580 CCCAGTTCCCAGCATACCTAAGT No data
Right 968054417 3:195680610-195680632 TCGTGATAGTAAAACTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054409 Original CRISPR ACTTAGGTATGCTGGGAACT GGG (reversed) Intergenic
No off target data available for this crispr