ID: 968054417

View in Genome Browser
Species Human (GRCh38)
Location 3:195680610-195680632
Sequence TCGTGATAGTAAAACTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054414_968054417 13 Left 968054414 3:195680574-195680596 CCTAAGTAAACTTCAGGTCCACT No data
Right 968054417 3:195680610-195680632 TCGTGATAGTAAAACTATGAAGG No data
968054415_968054417 -5 Left 968054415 3:195680592-195680614 CCACTCCTAGCACGTTTCTCGTG No data
Right 968054417 3:195680610-195680632 TCGTGATAGTAAAACTATGAAGG No data
968054412_968054417 21 Left 968054412 3:195680566-195680588 CCAGCATACCTAAGTAAACTTCA No data
Right 968054417 3:195680610-195680632 TCGTGATAGTAAAACTATGAAGG No data
968054411_968054417 22 Left 968054411 3:195680565-195680587 CCCAGCATACCTAAGTAAACTTC No data
Right 968054417 3:195680610-195680632 TCGTGATAGTAAAACTATGAAGG No data
968054416_968054417 -10 Left 968054416 3:195680597-195680619 CCTAGCACGTTTCTCGTGATAGT No data
Right 968054417 3:195680610-195680632 TCGTGATAGTAAAACTATGAAGG No data
968054410_968054417 28 Left 968054410 3:195680559-195680581 CCAGTTCCCAGCATACCTAAGTA No data
Right 968054417 3:195680610-195680632 TCGTGATAGTAAAACTATGAAGG No data
968054409_968054417 29 Left 968054409 3:195680558-195680580 CCCAGTTCCCAGCATACCTAAGT No data
Right 968054417 3:195680610-195680632 TCGTGATAGTAAAACTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054417 Original CRISPR TCGTGATAGTAAAACTATGA AGG Intergenic
No off target data available for this crispr