ID: 968054608

View in Genome Browser
Species Human (GRCh38)
Location 3:195681788-195681810
Sequence CAAAGTTACCAGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054608_968054615 3 Left 968054608 3:195681788-195681810 CCTTTTTCCCTCTGGTAACTTTG No data
Right 968054615 3:195681814-195681836 CCTGGGTTCTCGCCATTTTCTGG No data
968054608_968054617 30 Left 968054608 3:195681788-195681810 CCTTTTTCCCTCTGGTAACTTTG No data
Right 968054617 3:195681841-195681863 CTGTGACCTGTTCCTTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054608 Original CRISPR CAAAGTTACCAGAGGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr