ID: 968054866

View in Genome Browser
Species Human (GRCh38)
Location 3:195683777-195683799
Sequence CTGTTGCCCCTGGATGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054866_968054871 1 Left 968054866 3:195683777-195683799 CCAAGCCCATCCAGGGGCAACAG No data
Right 968054871 3:195683801-195683823 AGAAGCCCTTTGAGGTGCACTGG 0: 1
1: 3
2: 1
3: 19
4: 144
968054866_968054870 -7 Left 968054866 3:195683777-195683799 CCAAGCCCATCCAGGGGCAACAG No data
Right 968054870 3:195683793-195683815 GCAACAGAAGAAGCCCTTTGAGG No data
968054866_968054872 4 Left 968054866 3:195683777-195683799 CCAAGCCCATCCAGGGGCAACAG No data
Right 968054872 3:195683804-195683826 AGCCCTTTGAGGTGCACTGGAGG 0: 1
1: 3
2: 0
3: 17
4: 163
968054866_968054875 26 Left 968054866 3:195683777-195683799 CCAAGCCCATCCAGGGGCAACAG No data
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054866 Original CRISPR CTGTTGCCCCTGGATGGGCT TGG (reversed) Intergenic
No off target data available for this crispr