ID: 968054867

View in Genome Browser
Species Human (GRCh38)
Location 3:195683782-195683804
Sequence TTCTTCTGTTGCCCCTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054867_968054876 28 Left 968054867 3:195683782-195683804 CCCATCCAGGGGCAACAGAAGAA No data
Right 968054876 3:195683833-195683855 ACCCTGTCCTATGTGGACGTCGG No data
968054867_968054871 -4 Left 968054867 3:195683782-195683804 CCCATCCAGGGGCAACAGAAGAA No data
Right 968054871 3:195683801-195683823 AGAAGCCCTTTGAGGTGCACTGG 0: 1
1: 3
2: 1
3: 19
4: 144
968054867_968054875 21 Left 968054867 3:195683782-195683804 CCCATCCAGGGGCAACAGAAGAA No data
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data
968054867_968054872 -1 Left 968054867 3:195683782-195683804 CCCATCCAGGGGCAACAGAAGAA No data
Right 968054872 3:195683804-195683826 AGCCCTTTGAGGTGCACTGGAGG 0: 1
1: 3
2: 0
3: 17
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054867 Original CRISPR TTCTTCTGTTGCCCCTGGAT GGG (reversed) Intergenic
No off target data available for this crispr