ID: 968054868

View in Genome Browser
Species Human (GRCh38)
Location 3:195683783-195683805
Sequence CTTCTTCTGTTGCCCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054868_968054875 20 Left 968054868 3:195683783-195683805 CCATCCAGGGGCAACAGAAGAAG No data
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data
968054868_968054876 27 Left 968054868 3:195683783-195683805 CCATCCAGGGGCAACAGAAGAAG No data
Right 968054876 3:195683833-195683855 ACCCTGTCCTATGTGGACGTCGG No data
968054868_968054871 -5 Left 968054868 3:195683783-195683805 CCATCCAGGGGCAACAGAAGAAG No data
Right 968054871 3:195683801-195683823 AGAAGCCCTTTGAGGTGCACTGG 0: 1
1: 3
2: 1
3: 19
4: 144
968054868_968054872 -2 Left 968054868 3:195683783-195683805 CCATCCAGGGGCAACAGAAGAAG No data
Right 968054872 3:195683804-195683826 AGCCCTTTGAGGTGCACTGGAGG 0: 1
1: 3
2: 0
3: 17
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054868 Original CRISPR CTTCTTCTGTTGCCCCTGGA TGG (reversed) Intergenic
No off target data available for this crispr