ID: 968054869

View in Genome Browser
Species Human (GRCh38)
Location 3:195683787-195683809
Sequence AGGGCTTCTTCTGTTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054869_968054876 23 Left 968054869 3:195683787-195683809 CCAGGGGCAACAGAAGAAGCCCT No data
Right 968054876 3:195683833-195683855 ACCCTGTCCTATGTGGACGTCGG No data
968054869_968054881 30 Left 968054869 3:195683787-195683809 CCAGGGGCAACAGAAGAAGCCCT No data
Right 968054881 3:195683840-195683862 CCTATGTGGACGTCGGCACTGGG 0: 1
1: 3
2: 0
3: 4
4: 28
968054869_968054871 -9 Left 968054869 3:195683787-195683809 CCAGGGGCAACAGAAGAAGCCCT No data
Right 968054871 3:195683801-195683823 AGAAGCCCTTTGAGGTGCACTGG 0: 1
1: 3
2: 1
3: 19
4: 144
968054869_968054879 29 Left 968054869 3:195683787-195683809 CCAGGGGCAACAGAAGAAGCCCT No data
Right 968054879 3:195683839-195683861 TCCTATGTGGACGTCGGCACTGG 0: 1
1: 3
2: 0
3: 0
4: 31
968054869_968054872 -6 Left 968054869 3:195683787-195683809 CCAGGGGCAACAGAAGAAGCCCT No data
Right 968054872 3:195683804-195683826 AGCCCTTTGAGGTGCACTGGAGG 0: 1
1: 3
2: 0
3: 17
4: 163
968054869_968054875 16 Left 968054869 3:195683787-195683809 CCAGGGGCAACAGAAGAAGCCCT No data
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054869 Original CRISPR AGGGCTTCTTCTGTTGCCCC TGG (reversed) Intergenic
No off target data available for this crispr