ID: 968054871

View in Genome Browser
Species Human (GRCh38)
Location 3:195683801-195683823
Sequence AGAAGCCCTTTGAGGTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 3, 2: 1, 3: 19, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054867_968054871 -4 Left 968054867 3:195683782-195683804 CCCATCCAGGGGCAACAGAAGAA No data
Right 968054871 3:195683801-195683823 AGAAGCCCTTTGAGGTGCACTGG 0: 1
1: 3
2: 1
3: 19
4: 144
968054869_968054871 -9 Left 968054869 3:195683787-195683809 CCAGGGGCAACAGAAGAAGCCCT No data
Right 968054871 3:195683801-195683823 AGAAGCCCTTTGAGGTGCACTGG 0: 1
1: 3
2: 1
3: 19
4: 144
968054868_968054871 -5 Left 968054868 3:195683783-195683805 CCATCCAGGGGCAACAGAAGAAG No data
Right 968054871 3:195683801-195683823 AGAAGCCCTTTGAGGTGCACTGG 0: 1
1: 3
2: 1
3: 19
4: 144
968054866_968054871 1 Left 968054866 3:195683777-195683799 CCAAGCCCATCCAGGGGCAACAG No data
Right 968054871 3:195683801-195683823 AGAAGCCCTTTGAGGTGCACTGG 0: 1
1: 3
2: 1
3: 19
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054871 Original CRISPR AGAAGCCCTTTGAGGTGCAC TGG Intergenic
902923211 1:19679471-19679493 AGAAGCCCTCTGAGCTCCAGAGG + Exonic
903324188 1:22560431-22560453 GGGAGCCCTGTGAGGTGCATGGG - Intergenic
903803209 1:25985258-25985280 CATAGCCCTCTGAGGTGCACAGG - Intronic
905004338 1:34698062-34698084 TGAGGGCCTTTGAGGGGCACAGG - Intergenic
905518442 1:38579022-38579044 AAAAGCCCCCTGAGGTGAACAGG - Intergenic
908248835 1:62249196-62249218 AAAAGCCCTGCGAGGTACACAGG - Intronic
913215817 1:116619511-116619533 AGAAGCCCTTTGTGGGGCAGAGG - Intronic
917118718 1:171627244-171627266 GGAAGTCCTTAGAGGTGCACTGG - Intergenic
923077707 1:230624723-230624745 AGTAGCCCTTCCAGCTGCACAGG + Intergenic
924555009 1:245110823-245110845 AGAAGCCCTTTAAGGAACAAAGG - Intronic
1065266844 10:23985034-23985056 AGAAGTCCTTTGAGCTGAACAGG + Intronic
1065962274 10:30743419-30743441 TGAAGCCCTTTTAGGTTCCCTGG - Intergenic
1066793882 10:39097147-39097169 GGAAGCCCATTGAGGCCCACAGG + Intergenic
1066928331 10:41725696-41725718 GGAAGCCCTTTGAGGTCTATGGG + Intergenic
1069529577 10:69206687-69206709 AGAAACCCTCTGAGGTGGCCTGG - Intronic
1074053384 10:109900064-109900086 AGAAACCCTTAGAGTTGCAGAGG + Intronic
1075831554 10:125416362-125416384 AGCTGCCCTTTGATCTGCACAGG + Intergenic
1077431122 11:2516489-2516511 AGAAAGCCTTTGAGATGGACAGG + Intronic
1084799250 11:71531176-71531198 AGAAGGCCTTTGAGCAGCAAAGG + Intronic
1086966346 11:93032041-93032063 AGAAGGCCTTTGAGCTGTGCTGG - Intergenic
1086966459 11:93033020-93033042 AGAAGACCTTTGAGCTGTGCTGG + Intergenic
1087350738 11:97028949-97028971 CAAAGCTCTTTGAGGTGCTCAGG + Intergenic
1088129460 11:106470101-106470123 AAAAGCCCTTTGTGGTCCTCAGG + Intergenic
1089226655 11:116929403-116929425 AGAAGCACTTTGATGTGTTCTGG - Intronic
1091546588 12:1505117-1505139 AGATGCCCTTTGAGGTTTGCTGG + Intergenic
1092101503 12:5887883-5887905 AGAAACCTTTGGTGGTGCACAGG + Intronic
1094818864 12:34209738-34209760 AGAGGCCGACTGAGGTGCACGGG - Intergenic
1096674307 12:53218347-53218369 AGAAGCCCTTTGGGCTTGACTGG - Intronic
1097275604 12:57811432-57811454 ACAAGCCCTCTGTGGTGCAGGGG - Intronic
1099920161 12:88947457-88947479 ATAAGGCTTTTGAGGTGCAATGG - Intergenic
1100464762 12:94835134-94835156 AGAGGACCTTGGAGGTGGACAGG - Intergenic
1100670464 12:96806706-96806728 GGATTCCCTTTGAGGTGCTCTGG + Intronic
1103575824 12:121876485-121876507 AAAAGCCCTTTGATGTACCCCGG - Intergenic
1104607303 12:130199534-130199556 AGAAACCTTCTGAGGTGCATGGG + Intergenic
1105219549 13:18312991-18313013 AGAAGCCCTTTGTGGGGCAGAGG - Intergenic
1106573747 13:30955406-30955428 AGAAGCCATTTGCTGTGCAGAGG - Intronic
1109505729 13:63300353-63300375 AAAAGCACCTTGAGGTACACTGG + Intergenic
1110640406 13:77817556-77817578 GGGAGACATTTGAGGTGCACAGG - Intergenic
1113759695 13:112838723-112838745 AGAGGCCCTAGGAGGTCCACAGG - Intronic
1118508995 14:66449594-66449616 AGAAGCCCTTTAAGATGGCCTGG - Intergenic
1119204452 14:72783777-72783799 AGAGGCCCTTTGAGGGACATGGG - Intronic
1119841379 14:77795733-77795755 ACAAGCCCTTTGAGGTAGATAGG + Intergenic
1120698364 14:87669829-87669851 AAAAGCCCTTTGATGTCCAGTGG - Intergenic
1121830218 14:97045009-97045031 AGCAGACCTGTGAGGTGCCCAGG + Intergenic
1122227381 14:100287557-100287579 AGAAGCCCTTGGAGGTGTTGAGG - Intergenic
1202858372 14_GL000225v1_random:65003-65025 ACAGGCCGTTTGAGGTGCACGGG - Intergenic
1124204136 15:27702954-27702976 AGTAGCTCTATGATGTGCACAGG + Intergenic
1124463602 15:29916339-29916361 AGAAGCCCTATGAAATGCTCTGG + Intronic
1125510644 15:40290865-40290887 AGAAGCCCTTTGTTGTTCAGAGG + Intronic
1128916133 15:71564250-71564272 AGAAGCCCTTCAAGGGGCAGAGG + Intronic
1130084553 15:80766309-80766331 AGAAGCCCTTTCTGGAGCAGTGG - Intergenic
1132899220 16:2244271-2244293 AGAGGCCCTGAGATGTGCACAGG - Intronic
1134181787 16:12053824-12053846 AGCAGCCCTATGAGGTTCATGGG + Intronic
1142992324 17:3739680-3739702 AGAAGCCATTTGTGGGCCACGGG + Intronic
1143368985 17:6426733-6426755 AGAAGCCATGGGAGGTGCAGTGG - Exonic
1143420620 17:6788836-6788858 ACACACCCTTTCAGGTGCACAGG - Intronic
1143621874 17:8085499-8085521 AGAAGCCCTTTGAGTTCAACAGG - Intronic
1151106054 17:71618533-71618555 TGAAGCCCTTTGACATGCCCTGG - Intergenic
1152096123 17:78272674-78272696 AGCCGCCCTGTGAGTTGCACTGG + Intergenic
1152746250 17:82040890-82040912 AAAAGCAATTTGAGGTGCCCGGG + Intergenic
1153517935 18:5921782-5921804 ACAAGCCCTTGGAGGTGCACAGG + Intergenic
1155517367 18:26637051-26637073 TGAAGCCCTCCGAGGTGCTCTGG - Intronic
1157416683 18:47509328-47509350 AGAAGCCCATTTAGGTCCATGGG - Intergenic
1158461919 18:57653999-57654021 AGCAGCCCCATGAGGAGCACGGG + Exonic
925668600 2:6288728-6288750 AGCAGCCCTTTGAGAAGCAAGGG + Intergenic
934184501 2:89659527-89659549 AGAAGCCCTTTGTGGGGCAGAGG + Intergenic
934294783 2:91733664-91733686 AGAAGCCCTTTGTGGGGCAGAGG + Intergenic
938715537 2:134018204-134018226 AGAGGCCCCTTGAGCTTCACAGG - Intergenic
942701481 2:178716096-178716118 GGAAGCCCTCTGAGGTCCACGGG + Intronic
943649809 2:190445059-190445081 TGAGGCCCTTTGAGTTGAACTGG + Intronic
945065199 2:205942319-205942341 AGCAGCTCTCTGAGGAGCACTGG + Intergenic
945722121 2:213430320-213430342 AGAAGGCCTTTGAGAAGTACAGG + Intronic
946125987 2:217563127-217563149 AAAAGCCCTTTGAAGTGGACAGG + Intronic
948104991 2:235406308-235406330 AGGGGCCCTTGGAGGTCCACAGG + Intergenic
948151498 2:235748180-235748202 AGAAGCCCGTTTTGGTGCAGTGG + Intronic
948825037 2:240569962-240569984 GGAAGCCCATAGGGGTGCACTGG - Intronic
1171021379 20:21587156-21587178 AAAAGCCTCTTGAGGAGCACTGG - Intergenic
1171176411 20:23053268-23053290 TGAAGCCTTGTGAGGTGCAAGGG - Intergenic
1171206933 20:23288623-23288645 AGAGGGCCTGTGAGGGGCACTGG - Intergenic
1171771062 20:29324010-29324032 AGAGGCCAACTGAGGTGCACTGG + Intergenic
1171780412 20:29411663-29411685 AGAGGCCAGCTGAGGTGCACGGG - Intergenic
1172165476 20:32896337-32896359 AAAAGCCTTTTGAGAAGCACAGG + Intronic
1175034644 20:55988561-55988583 GGAAGTCCTTTCAGTTGCACTGG + Intergenic
1178259645 21:31087090-31087112 AGAAGCCCTGAGAGGTGCTATGG - Intergenic
1180184984 21:46135050-46135072 AGAGGCCCCTGCAGGTGCACAGG + Intergenic
1180231962 21:46431944-46431966 AGAAGCACTGTGAGGCGCTCAGG + Exonic
1180784517 22:18539380-18539402 AGAAGCCCTCTGAGGGGGCCAGG + Intergenic
1180817151 22:18797851-18797873 AGAAGCCCTTTGTGGGGCAGAGG - Intergenic
1181128094 22:20713433-20713455 AGAAGCCCTCTGAGGGGGCCAGG + Intronic
1181203341 22:21232196-21232218 AGAAGCCCTTTGTGGGGCAGAGG - Intergenic
1181241420 22:21478737-21478759 AGAAGCCCTCTGAGGGGGCCAGG + Intergenic
1182239179 22:28901164-28901186 AGAGGCTCTTTGAGTTGAACTGG - Intronic
1184550554 22:45202279-45202301 AGAAGCCTTTGGTGGGGCACAGG - Intronic
1203223578 22_KI270731v1_random:63228-63250 AGAAGCCCTTTGTGGGGCAGAGG + Intergenic
1203267250 22_KI270734v1_random:23572-23594 AGAAGCCCTTTGTGGGGCAGAGG - Intergenic
950012180 3:9731614-9731636 AGAAGCCCTGTGGGGTGTCCAGG + Intergenic
950737645 3:15023215-15023237 GGAAGCCCTTCGATGTGCAACGG + Exonic
951538912 3:23764164-23764186 AGAAGCCCTATGAGGTTTTCTGG - Intergenic
953004743 3:38967783-38967805 AGTAGCCCTTTGATGAGCCCTGG - Intergenic
953933126 3:47016858-47016880 AGAAGCCATCAGAGGTGCAAGGG - Exonic
954150566 3:48655171-48655193 AGATGCCCTAGGGGGTGCACAGG - Exonic
956264850 3:67385369-67385391 ATAAGACCTGTGATGTGCACTGG + Intronic
957084670 3:75668848-75668870 AGAGGCCGGCTGAGGTGCACGGG + Intergenic
958815295 3:98907718-98907740 ACACACCCTTTAAGGTGCACTGG - Intergenic
959888495 3:111528405-111528427 AGAAGCAATCTGAGGTGCCCAGG - Intronic
961922394 3:130441384-130441406 AGCAACCCTTTGTAGTGCACTGG - Intronic
965416215 3:168396407-168396429 AGAAACCCAATGAGGAGCACAGG + Intergenic
968054871 3:195683801-195683823 AGAAGCCCTTTGAGGTGCACTGG + Intergenic
968101039 3:195965471-195965493 AGAAGCCCTTTGAGGAGCACTGG - Intergenic
968521006 4:1034690-1034712 CCAAGCCCTTGGAGGTGGACAGG - Intergenic
975494882 4:75026860-75026882 AGTAGCCCTATGAGGTGGAGAGG + Intronic
982045331 4:151439467-151439489 AGAAGCCCTTTCAGTTGCTTTGG - Intronic
985502043 5:254442-254464 AGAAGCCCTTTGAGGAGCACTGG + Exonic
985734975 5:1574224-1574246 AGAAGCCCTTTGAGGAGCACTGG - Intergenic
987566600 5:19596260-19596282 AGAAGCCATGTGATTTGCACTGG + Intronic
991006054 5:61829060-61829082 ATAAGCCCTATGAGGTGAAAAGG - Intergenic
992943950 5:81790957-81790979 AGAAGCCCTTGGAGAAGCCCTGG + Intergenic
996461003 5:123742998-123743020 AAAAGCCCTTTCAGGTGGATAGG + Intergenic
997650591 5:135515066-135515088 AGAAACCCTTTGAGAAGGACTGG + Intergenic
1000496399 5:161989955-161989977 TGAAGACCTTTGACATGCACTGG + Intergenic
1001361753 5:171092798-171092820 AGAAGCTCCTTGTAGTGCACAGG - Intronic
1004517597 6:16333828-16333850 GGAAGGCCTGTGTGGTGCACTGG + Intronic
1008127561 6:47685991-47686013 AGAGGCCTGTTGAGGTGCATGGG - Intronic
1008440013 6:51521850-51521872 AAAAGCCCTTTGAAGTACACAGG + Intergenic
1008805936 6:55428322-55428344 ATAAGCTCTTTGTGGTACACAGG - Intergenic
1011245286 6:85315566-85315588 AGAAGCTGTGTGAGGTGCTCTGG - Intergenic
1011817841 6:91213629-91213651 AGCAGCCTTTTGGGTTGCACAGG - Intergenic
1014612132 6:123559115-123559137 AGGAGCCTTTTGAGGTGATCGGG - Intronic
1016807092 6:148222475-148222497 AGAAGCGATTTGAAGTGCACAGG - Intergenic
1017224266 6:152001911-152001933 AGGAGCCCTTTGGGGTCCAAGGG - Intronic
1018104192 6:160467445-160467467 AGAAGCCTTTAGTGCTGCACGGG - Intergenic
1018462682 6:164013922-164013944 AGAAGCCCTTTGAGTTCTTCTGG + Intergenic
1022955063 7:35373109-35373131 AGATGCCCTTCGAGGTGGAGTGG - Intergenic
1023270369 7:38455929-38455951 AGCAGCCCTCAGAGGTGCATAGG - Intronic
1025535046 7:61937142-61937164 AAAAGCCCTTTGAGGCCTACAGG + Intergenic
1031384042 7:121124362-121124384 AAAAGCCTGTTGAGGTGAACTGG - Exonic
1035579768 8:732125-732147 AGAGGCCCTTGGAGCTGGACAGG - Intronic
1035898691 8:3434123-3434145 AGAATACCTTTGAGGTTCTCTGG + Intronic
1036569808 8:9970292-9970314 AGGAGCCCTGGGAGGTGCAATGG + Intergenic
1037826305 8:22162619-22162641 AGAAGGCGTTTCAGGTGCACTGG - Exonic
1040127042 8:43749401-43749423 AGAAGCCCTTTGAGGCCTACAGG + Intergenic
1040139210 8:43890907-43890929 AGGAGCCCTTTGAGGACTACGGG + Intergenic
1043817288 8:84817053-84817075 CTAAGTCCTTTGAGATGCACGGG + Intronic
1043963746 8:86447798-86447820 AGCTGCCTTTTCAGGTGCACAGG + Intronic
1045776149 8:105805531-105805553 GAAAGACCTTTGTGGTGCACAGG + Intergenic
1049321820 8:142000790-142000812 AGAAGCCCCTGGAGGAGCAGTGG - Intergenic
1050264102 9:3871769-3871791 TGAAGACCTCTGAGATGCACTGG + Intronic
1051364934 9:16315220-16315242 AGCAGGCCTTTGAGGTGAGCAGG + Intergenic
1058005089 9:99906239-99906261 AAAAGCCCTGTGAAGTGGACAGG - Intergenic
1058230296 9:102417014-102417036 TGAAGACCTCTGAGGTGCCCTGG - Intergenic
1058974005 9:110109381-110109403 AGAAGCCTTCTGAGGTTCAGAGG + Intronic
1059198552 9:112394005-112394027 AGAAGCAATCTGAGGTGCCCAGG + Intronic
1059674551 9:116525487-116525509 AGAAGCCATCTGTGGTGCAAAGG - Intronic
1060213375 9:121723925-121723947 AGAAGCCCTGGGAGGTGGGCAGG - Intronic
1060391932 9:123284875-123284897 AGCAGCTGTATGAGGTGCACAGG + Intergenic
1187524764 X:20044372-20044394 AGAAGCCCTTTCAGGAGGAGAGG - Exonic
1188729755 X:33631538-33631560 AGATGCCAATTGTGGTGCACTGG - Intergenic
1189474288 X:41337280-41337302 ATTAGCCCTGTGAGGTGGACTGG + Intronic
1190778006 X:53569647-53569669 AGCAGCCCTTGGACGGGCACTGG - Exonic
1191577904 X:62727011-62727033 AGAAGCCCTTTGAGGCCTATGGG - Intergenic
1191578167 X:62730135-62730157 GGGAGCCCATTGAGGTGCATGGG - Intergenic
1194161603 X:90459207-90459229 AGAAGTCCTTGGTGGGGCACAGG + Intergenic
1195314674 X:103665978-103666000 AGAAGGGCTTTGATGTGCCCTGG + Intergenic
1195666623 X:107437257-107437279 ACAGGCCCTTTCAGGAGCACTGG + Intergenic
1197763536 X:130044352-130044374 AGAATCCCTTTAGGGTGCACAGG + Intronic
1197880421 X:131160779-131160801 ATAAGCTTTTTGATGTGCACTGG + Intergenic
1200701156 Y:6403633-6403655 AGAATTCCCTGGAGGTGCACCGG - Intergenic
1201032956 Y:9761065-9761087 AGAATTCCCTGGAGGTGCACCGG + Intergenic