ID: 968054872

View in Genome Browser
Species Human (GRCh38)
Location 3:195683804-195683826
Sequence AGCCCTTTGAGGTGCACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 3, 2: 0, 3: 17, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054868_968054872 -2 Left 968054868 3:195683783-195683805 CCATCCAGGGGCAACAGAAGAAG No data
Right 968054872 3:195683804-195683826 AGCCCTTTGAGGTGCACTGGAGG 0: 1
1: 3
2: 0
3: 17
4: 163
968054869_968054872 -6 Left 968054869 3:195683787-195683809 CCAGGGGCAACAGAAGAAGCCCT No data
Right 968054872 3:195683804-195683826 AGCCCTTTGAGGTGCACTGGAGG 0: 1
1: 3
2: 0
3: 17
4: 163
968054867_968054872 -1 Left 968054867 3:195683782-195683804 CCCATCCAGGGGCAACAGAAGAA No data
Right 968054872 3:195683804-195683826 AGCCCTTTGAGGTGCACTGGAGG 0: 1
1: 3
2: 0
3: 17
4: 163
968054866_968054872 4 Left 968054866 3:195683777-195683799 CCAAGCCCATCCAGGGGCAACAG No data
Right 968054872 3:195683804-195683826 AGCCCTTTGAGGTGCACTGGAGG 0: 1
1: 3
2: 0
3: 17
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054872 Original CRISPR AGCCCTTTGAGGTGCACTGG AGG Intergenic
900369788 1:2326563-2326585 AGCCCTGGGCGGTGGACTGGGGG + Intronic
900660603 1:3780728-3780750 AGCACTTTGAGGGGCAGAGGTGG + Exonic
900930064 1:5730855-5730877 GGCTCTTTGAGGGGCACTGTGGG - Intergenic
903324187 1:22560428-22560450 AGCCCTGTGAGGTGCATGGGTGG - Intergenic
903348100 1:22700611-22700633 AGCACTTTGAGGGGCTCAGGTGG + Intergenic
903550471 1:24154404-24154426 AGCCCTTTCACGTGCACAGCAGG - Exonic
905242075 1:36587949-36587971 AGCCCTATGAGGTGCAGGGAGGG + Intergenic
905559167 1:38912666-38912688 AGCCCTTTGAGGGGCTGAGGTGG - Intronic
906470150 1:46122613-46122635 AGCACTTTGAGGTGCCGAGGTGG - Intronic
907274722 1:53310839-53310861 GGCCCTGTGATGGGCACTGGGGG + Intronic
909000587 1:70212820-70212842 AGCACTTTGGGATGCCCTGGTGG + Intronic
912267544 1:108174143-108174165 AGACCTCTGAAGTGCCCTGGAGG - Intronic
912337954 1:108880345-108880367 AGCACTTTGAGGGGCCCAGGTGG + Intronic
913366562 1:118046088-118046110 AGCACTTTGAGAGGCCCTGGAGG + Intronic
914502524 1:148259657-148259679 AGCACTTTGAGGGGCTCAGGTGG + Intergenic
920402798 1:205687217-205687239 AGCACTTTGAGGGGCAGAGGTGG - Intergenic
920686624 1:208113801-208113823 AACACTTTGAGTTGCTCTGGCGG - Intronic
922219455 1:223547157-223547179 AGCACTTTGGGTGGCACTGGTGG - Intronic
1063682493 10:8202509-8202531 AGCACTTTGAGGGGCAGAGGCGG - Intergenic
1066321244 10:34306044-34306066 AGCACTTTGAGAGGCACAGGTGG + Intronic
1068514640 10:58010521-58010543 AGCCCTTAGAGGCTCAGTGGAGG - Intergenic
1069291893 10:66790199-66790221 AGCACTTTGGGGTGCCCAGGCGG + Intronic
1069920884 10:71815027-71815049 GGCCCCTTGAGCTCCACTGGTGG - Exonic
1070059183 10:72966091-72966113 AGCACTTTGAGAGGCACAGGAGG - Intergenic
1074505647 10:114067969-114067991 AGCACTTTGCGGGGCAGTGGTGG - Intergenic
1075817837 10:125279500-125279522 AGGCTTTTGAGGGGCAATGGGGG + Intergenic
1075831555 10:125416365-125416387 TGCCCTTTGATCTGCACAGGTGG + Intergenic
1076205637 10:128599094-128599116 AGCACTTTGACAGGCACTGGAGG - Intergenic
1076413942 10:130271577-130271599 AGCTCTGTGAGGTGCCCAGGAGG + Intergenic
1076691359 10:132225272-132225294 ACTCCTTCGAGGTGGACTGGTGG - Exonic
1078600523 11:12726424-12726446 AGGCCTGTGCTGTGCACTGGGGG + Intronic
1079388928 11:20004187-20004209 AGCCTTTTGAGGTGATATGGAGG - Intronic
1082259657 11:50068874-50068896 AGCCCTTTGAGATGCTCTGCTGG + Intergenic
1083601877 11:63953875-63953897 AGCACTTTGAGGGGCAAAGGTGG - Intronic
1083915437 11:65740218-65740240 AGGCCTTTGAGGTTCACTGCTGG - Intergenic
1084524842 11:69690166-69690188 CATACTTTGAGGTGCACTGGAGG + Intergenic
1085204827 11:74725236-74725258 AGCCCTTTGGGAGGCCCTGGCGG - Intronic
1090394063 11:126407487-126407509 AGCGCTCTGAGGAGCAGTGGAGG + Intronic
1092865241 12:12754676-12754698 AGCACTTTGGGGTGCTCAGGTGG - Intronic
1094014750 12:25850433-25850455 AGCACTTTGAGGGGCCCAGGTGG + Intergenic
1094272326 12:28630475-28630497 TGCTCTCTGAGGTGCACTGATGG + Intergenic
1096178044 12:49535969-49535991 AGTTCTTTGAGGGGCAATGGGGG + Intergenic
1096518169 12:52169860-52169882 AGGCCTGTGGGGAGCACTGGAGG - Exonic
1100242217 12:92721217-92721239 AGACATTTGAGGTCTACTGGGGG + Intergenic
1100510360 12:95265106-95265128 AGCACTTTGAGAGGCACAGGTGG - Intronic
1104322096 12:127761393-127761415 TGCTCTTTGAGGTGCTCTTGGGG + Intergenic
1104590396 12:130080177-130080199 AGCACTTTGAGGGGCAGAGGCGG - Intergenic
1105528391 13:21196813-21196835 AGCACTTTGAGAGGCACAGGTGG - Intergenic
1109876309 13:68408289-68408311 AGTCCTTTGAGGTTCACTAGAGG - Intergenic
1117904693 14:60572239-60572261 AGGCCTTGGAGCTGCAGTGGTGG + Intergenic
1118376550 14:65182457-65182479 ATGCCTCTGTGGTGCACTGGTGG + Intergenic
1118769339 14:68931404-68931426 AGCCCTTTGAGGGGAACTTTGGG + Intronic
1121071794 14:91030082-91030104 AGCCTTTTGGGGTTCTCTGGGGG - Intronic
1122783278 14:104152738-104152760 AGCCCTGTGCTGGGCACTGGTGG - Intronic
1123233647 15:17160547-17160569 AGCCCTTTGTGGTCCTGTGGTGG + Intergenic
1123246285 15:17378993-17379015 AGCCCTTTGTGGTCCTGTGGTGG + Intergenic
1123251956 15:17478244-17478266 AGCCCTTTGTGGTCCTGTGGTGG + Intergenic
1124619529 15:31265882-31265904 AGCCCTTTGATGTGCCTTGATGG + Intergenic
1127786427 15:62359364-62359386 AGCACTTTGAGGGGCAGAGGTGG - Intergenic
1127948079 15:63775586-63775608 AGCCATTTCAGCTTCACTGGTGG + Exonic
1128233875 15:66054029-66054051 ACCCCTTTGATCTCCACTGGAGG + Intronic
1128508964 15:68302010-68302032 AGCCCTTCCCTGTGCACTGGCGG + Exonic
1129429636 15:75490169-75490191 AATCTTTTTAGGTGCACTGGGGG - Intronic
1130104598 15:80919893-80919915 GGCCCTGGGAGGAGCACTGGAGG - Intronic
1130254494 15:82319637-82319659 ACCCCTGTGAGCTGCACTGCCGG + Intergenic
1130384537 15:83399852-83399874 AGCACCTTGAGGTGGAGTGGAGG - Intergenic
1130600471 15:85270333-85270355 ACCCCTGTGAGCTGCACTGCCGG - Intergenic
1133196843 16:4177154-4177176 AGGGCTTTGAGCTGCACTGTAGG + Intergenic
1134040675 16:11065990-11066012 GGGCCTTCGAGCTGCACTGGGGG + Intronic
1136533574 16:30886085-30886107 AGGCCTTTGAGAGGCACAGGTGG - Intronic
1136655561 16:31707096-31707118 AGCCCTGTCAGGTGCCCTGAAGG + Intergenic
1136984394 16:35085169-35085191 AGCCCTGTCAGGTGCCCTGAAGG + Intergenic
1137454209 16:48605847-48605869 AGCACTTTGTGATCCACTGGAGG + Intronic
1137632232 16:49955068-49955090 AACCCTTTGGGGTGCCCTGAAGG - Intergenic
1138436892 16:57006244-57006266 AGCACTTTGAGGGGCAAAGGCGG - Intronic
1142203220 16:88770861-88770883 AGGCCAGTGAGGTGCCCTGGGGG + Intronic
1142398025 16:89843946-89843968 AGCACTTTGAGGTGCCACGGCGG - Intronic
1144083039 17:11781912-11781934 AGCCCTCTGAGCTGCTCTGAAGG - Intronic
1144087400 17:11823088-11823110 AGCCCTTTCCAGTGAACTGGAGG + Intronic
1148476013 17:47929151-47929173 GGCCCTTGGAGGTGCTCTGGGGG - Intergenic
1149129328 17:53277923-53277945 AGCCCTTAGTGGTGCACACGTGG - Intergenic
1153841398 18:9011363-9011385 AGCCCATTGAGGTGAAGTGAGGG + Intergenic
1154945069 18:21154634-21154656 AGCCCCTTGAGGTGCATTGTTGG + Intergenic
1155517366 18:26637048-26637070 AGCCCTCCGAGGTGCTCTGGAGG - Intronic
1156316522 18:35973671-35973693 AGCACTTTGAGATGCAGAGGCGG + Intronic
1157957525 18:52114870-52114892 AGCCCTTTGAGAGGCTGTGGCGG + Intergenic
1160374700 18:78402531-78402553 AGTCCTGTGAGGTGCACAGTTGG - Intergenic
1160895257 19:1399429-1399451 GTCCCTCTGATGTGCACTGGGGG - Intronic
1161454882 19:4365169-4365191 GGCCCTTTTAGGAGCATTGGAGG - Intronic
1163690308 19:18735096-18735118 GGCCCTTGGAGGAGCACAGGAGG + Intronic
1163777758 19:19227967-19227989 AGCCCTTTGCTGTACACTGAGGG - Exonic
1164563581 19:29310416-29310438 TTCCCTTTGAGGTGCAGGGGTGG - Intergenic
1166783176 19:45352801-45352823 CGCCCGTAGTGGTGCACTGGTGG + Exonic
1167526270 19:49985806-49985828 AGGCTTATGAGGTGAACTGGTGG - Intronic
925040495 2:729804-729826 GGCCCTTTGAGGTGTGCAGGGGG + Intergenic
925398280 2:3552641-3552663 AGCCCCTTGAGATGCTGTGGAGG - Intronic
927199658 2:20570537-20570559 AGCCCTTGGGGCTGCAATGGAGG - Intronic
928789470 2:34933417-34933439 AGGCCTTTGGGGTTCACTGTTGG - Intergenic
931208174 2:60167607-60167629 TTCCCTTTGAGGAGCCCTGGTGG - Intergenic
932008644 2:67953513-67953535 AGCACACTGAGGTGCACTGGGGG + Intergenic
934950972 2:98575209-98575231 AGCCACTTGTGGTGCACTGCTGG - Intronic
938676404 2:133639691-133639713 AGGGCTTTGAGATGCACTGATGG - Intergenic
940524296 2:154792364-154792386 AGCCCTTTGGGTTGCCCTGTGGG + Intronic
940859525 2:158757586-158757608 AGCCCTTTAAGGTACACTCCGGG + Intergenic
942386474 2:175448802-175448824 AGCTCTTTGAAGTGGACAGGAGG - Intergenic
942808573 2:179967425-179967447 AGACCTGTGAGGTGGTCTGGAGG + Intronic
943179358 2:184524102-184524124 AGCCCTTTGGGGAGCCCTGGGGG - Intergenic
946919787 2:224567042-224567064 AGCACTTCCAGGTTCACTGGGGG + Intronic
947248071 2:228072202-228072224 AGGCCTTTGAATTGCACTGCTGG + Intronic
948122627 2:235542778-235542800 AGCCATTTGAGATGCCCTGCAGG + Intronic
948781815 2:240326128-240326150 AGCCCCTTCAGGTCCACTGATGG + Intergenic
1169707428 20:8521454-8521476 AGCACTTTGAGATGCTCAGGTGG + Intronic
1172422181 20:34826783-34826805 AGCACTTTGAGGGGCAGAGGCGG - Intergenic
1173751425 20:45479845-45479867 AGCCCAGTGAGGGGCAGTGGGGG + Intronic
1174208336 20:48857432-48857454 AGCCCTTTGAGATGCCATGGCGG + Intergenic
1175619916 20:60434771-60434793 GGCCATGTGAGGTGGACTGGAGG + Intergenic
1175964047 20:62651433-62651455 AGCCCCTGGAGGTGCACAGCTGG + Intronic
1182333882 22:29570354-29570376 TGCCCTTTCAGGGGCTCTGGGGG - Intronic
1184661658 22:45968222-45968244 AGCCCTCTGAGATGCCCTAGGGG + Intronic
1184957716 22:47902891-47902913 AGTGCTCTGAGGTCCACTGGTGG - Intergenic
1185131949 22:49044305-49044327 TGCCCTGGCAGGTGCACTGGGGG + Intergenic
950602200 3:14044832-14044854 AGGCCTTTGAGGAAGACTGGGGG - Intronic
951538911 3:23764161-23764183 AGCCCTATGAGGTTTTCTGGAGG - Intergenic
953384894 3:42500981-42501003 GGCCCTGTGCTGTGCACTGGGGG - Intronic
955176674 3:56621230-56621252 AGCACTTGGGGGTGGACTGGGGG + Intronic
956264853 3:67385372-67385394 AGACCTGTGATGTGCACTGGGGG + Intronic
959771742 3:110107206-110107228 AGGAGTTTCAGGTGCACTGGGGG + Intergenic
961133053 3:124486698-124486720 AGGGCTTGGAGCTGCACTGGTGG - Intronic
961909661 3:130301555-130301577 AGCCCTTTGGGGTTCACTGTTGG + Intergenic
962372026 3:134828686-134828708 GGCCCTTTGAGGGACACTTGGGG + Intronic
962417846 3:135200129-135200151 AGCCCTTTGGGGAGCATTTGGGG + Intronic
968054872 3:195683804-195683826 AGCCCTTTGAGGTGCACTGGAGG + Intergenic
968101038 3:195965468-195965490 AGCCCTTTGAGGAGCACTGGAGG - Intergenic
976637921 4:87306657-87306679 AGCACTTTGAGAGGCACAGGTGG + Intronic
977788876 4:101074206-101074228 AGCTCTTTGATGTGCTGTGGTGG + Intronic
983957347 4:173713838-173713860 AGCCCTTTGAGGTGGGCTTGGGG + Intergenic
985502044 5:254445-254467 AGCCCTTTGAGGAGCACTGGAGG + Exonic
985734974 5:1574221-1574243 AGCCCTTTGAGGAGCACTGGAGG - Intergenic
988217887 5:28300418-28300440 AGCACTTTGAGGGGCCCAGGCGG - Intergenic
989578589 5:43011177-43011199 AGTCCTTTAATGTGCCCTGGGGG + Intergenic
992647810 5:78828477-78828499 AACTCTTTGAGGTTCAGTGGAGG + Intronic
995453295 5:112326261-112326283 ATGCCTTTGAGGTGGATTGGGGG - Intronic
997362598 5:133304813-133304835 AGCCCTCTGTGGTGTAATGGGGG + Intronic
1000936247 5:167305827-167305849 ATACTTGTGAGGTGCACTGGAGG - Intronic
1001301149 5:170534767-170534789 AGCACTTTGAGAGGCTCTGGTGG - Intronic
1003122970 6:3333348-3333370 AGCCCTTGGAGGGGCACGTGTGG - Intronic
1003600284 6:7510619-7510641 AGCCCTTTGAGGGGCTGAGGTGG - Intergenic
1006391577 6:33761877-33761899 AGCCCTCTCAGCTCCACTGGGGG - Intergenic
1007020564 6:38516479-38516501 AGCCCTTCAAGCTGCATTGGAGG - Intronic
1011602633 6:89074242-89074264 AGCGCTTTGGGAGGCACTGGTGG + Intergenic
1013326907 6:109055413-109055435 AGCCCTTTGAGGGGCTGAGGTGG + Intronic
1015855343 6:137618298-137618320 AGCACTGGGAGGTGCATTGGTGG + Intergenic
1019289290 7:242500-242522 AGCACTGTTCGGTGCACTGGGGG + Intronic
1019413494 7:916921-916943 AGCCCAGGGAGGTGCACGGGAGG + Intronic
1020915753 7:14190455-14190477 AGGCCTTTGAGATGCATTGTTGG - Intronic
1023983584 7:45082873-45082895 AGCACTTGGAGGTGCAAGGGAGG - Exonic
1025175525 7:56799460-56799482 AGCCCTTTGAGATGCTCTGCTGG + Intergenic
1025696274 7:63776960-63776982 AGCCCTTTGAGATGCTCTGCTGG - Intergenic
1025913158 7:65843867-65843889 AGCCCTTTGAGATGCTCTGCTGG - Intergenic
1025976467 7:66374585-66374607 AGCCCTTTAAGATGCTCTGCTGG + Intronic
1026330864 7:69351482-69351504 AGCACTTTGGGGTGCAAAGGTGG - Intergenic
1026768125 7:73173222-73173244 AGGCCTCTGAGGAGCCCTGGTGG + Intergenic
1027044590 7:74982932-74982954 AGGCCTCTGAGGAGCCCTGGTGG + Intronic
1027079048 7:75219428-75219450 AGGCCTCTGAGGAGCCCTGGTGG - Intergenic
1029388280 7:100257997-100258019 AGGCCTCTGAGGAGCCCTGGTGG - Intronic
1031450423 7:121910465-121910487 AGGCACTTGAGATGCACTGGTGG - Intronic
1031627310 7:124005395-124005417 TACCTTGTGAGGTGCACTGGAGG + Intergenic
1034649929 7:152682172-152682194 AGCACTTTGAGGGGCAAAGGTGG + Intergenic
1037648563 8:20816170-20816192 AGCACTTTGTGGTGCTGTGGTGG + Intergenic
1044572424 8:93734527-93734549 GGCCCCTTGAGGAGGACTGGAGG - Exonic
1045656423 8:104391855-104391877 AGCCCTTTGAGAGGCAGAGGTGG - Intronic
1046088805 8:109473262-109473284 AGCCCTTTGGGGGGCAAAGGTGG + Intronic
1049524005 8:143111585-143111607 AGCACTTTGAGGGGCAGAGGTGG - Intergenic
1049674769 8:143884514-143884536 ACCCCTGTGAAGGGCACTGGTGG - Intergenic
1052260546 9:26511002-26511024 AGCCCTATGCTGTGCTCTGGGGG - Intergenic
1062701192 9:137904613-137904635 AGCCCTTTGAGAGGCAGAGGTGG - Intronic
1185634070 X:1538504-1538526 AGCACTTTGAGGTGCCAAGGTGG + Intergenic
1185833097 X:3320176-3320198 AGAACTTTGAGCTGCTCTGGTGG + Exonic
1189807869 X:44753316-44753338 AGCACTTTGAGGGGCAGAGGCGG - Intergenic
1190061963 X:47217531-47217553 AGCCCTTTGAGCTGGACTTGGGG + Intergenic
1194152647 X:90344595-90344617 AGGCCTTTGGGGTTCACTGTTGG - Intergenic
1194619778 X:96156849-96156871 AGCACTTTCAGCTTCACTGGTGG - Intergenic
1195448119 X:104976771-104976793 AGGCCTTTGGGGTTCACTGTTGG - Intronic
1200498994 Y:3921340-3921362 AGGCCTTTGGGGTTCACTGTTGG - Intergenic