ID: 968054873

View in Genome Browser
Species Human (GRCh38)
Location 3:195683806-195683828
Sequence TTCCTCCAGTGCACCTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 3, 2: 1, 3: 9, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054873_968054882 15 Left 968054873 3:195683806-195683828 CCCTTTGAGGTGCACTGGAGGAA 0: 1
1: 3
2: 1
3: 9
4: 125
Right 968054882 3:195683844-195683866 TGTGGACGTCGGCACTGGGAAGG 0: 1
1: 3
2: 1
3: 2
4: 100
968054873_968054883 24 Left 968054873 3:195683806-195683828 CCCTTTGAGGTGCACTGGAGGAA 0: 1
1: 3
2: 1
3: 9
4: 125
Right 968054883 3:195683853-195683875 CGGCACTGGGAAGGTCAGTGTGG 0: 1
1: 3
2: 1
3: 17
4: 228
968054873_968054876 4 Left 968054873 3:195683806-195683828 CCCTTTGAGGTGCACTGGAGGAA 0: 1
1: 3
2: 1
3: 9
4: 125
Right 968054876 3:195683833-195683855 ACCCTGTCCTATGTGGACGTCGG No data
968054873_968054875 -3 Left 968054873 3:195683806-195683828 CCCTTTGAGGTGCACTGGAGGAA 0: 1
1: 3
2: 1
3: 9
4: 125
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data
968054873_968054881 11 Left 968054873 3:195683806-195683828 CCCTTTGAGGTGCACTGGAGGAA 0: 1
1: 3
2: 1
3: 9
4: 125
Right 968054881 3:195683840-195683862 CCTATGTGGACGTCGGCACTGGG 0: 1
1: 3
2: 0
3: 4
4: 28
968054873_968054879 10 Left 968054873 3:195683806-195683828 CCCTTTGAGGTGCACTGGAGGAA 0: 1
1: 3
2: 1
3: 9
4: 125
Right 968054879 3:195683839-195683861 TCCTATGTGGACGTCGGCACTGG 0: 1
1: 3
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054873 Original CRISPR TTCCTCCAGTGCACCTCAAA GGG (reversed) Intergenic
903324186 1:22560426-22560448 TTCCACCCATGCACCTCACAGGG + Intergenic
904582368 1:31554542-31554564 TTAGTCCAGTTCAACTCAAATGG - Intergenic
907893170 1:58656067-58656089 TTCCTCCAGCTCACCTCATCAGG + Exonic
911758061 1:101583417-101583439 TTTTTCCAGTGTTCCTCAAAAGG - Intergenic
913326792 1:117634830-117634852 TTCCTCCATTGCACCTCCTCAGG + Intergenic
917745587 1:178003506-178003528 TTCCTCCATTAGACCTCAGATGG + Intergenic
918475250 1:184917677-184917699 CTCCTCCTGTCCACCTCAAAAGG + Intronic
918574901 1:186046158-186046180 TTTGTCCAGAGCACCTAAAATGG - Intronic
919532541 1:198742007-198742029 TACCTGCAGTGCACCACAATGGG - Exonic
921114334 1:212073140-212073162 TTTCTCCACTGGACTTCAAATGG - Intronic
923798596 1:237184649-237184671 GTCCACCATTGTACCTCAAATGG - Intronic
1062899720 10:1133884-1133906 TTCATCCTCTGCACCTGAAAGGG + Intergenic
1063343508 10:5291082-5291104 TTCTTTCAGTGCAGCTAAAAAGG - Intergenic
1068933013 10:62610818-62610840 TTCCTCCAGTCGACCTAAAGAGG + Intronic
1070359034 10:75669302-75669324 TTCCCCCAGAGAACCTCATAGGG - Intronic
1071088304 10:81890008-81890030 TTCCTCCAATACACTGCAAATGG + Intronic
1072435950 10:95414832-95414854 TTCCTCCAGTGCAGCCCAGCCGG - Exonic
1074905638 10:117861067-117861089 TTTCTCCAGTGTACCACATATGG + Intergenic
1075831556 10:125416367-125416389 TTCCACCTGTGCAGATCAAAGGG - Intergenic
1076595349 10:131621845-131621867 TTCCTGCAGGGAACCTCACAGGG + Intergenic
1077971879 11:7202210-7202232 TTTCTCCAGTGCACTTTAGAAGG + Intergenic
1079388926 11:20004185-20004207 TCCCTCCATATCACCTCAAAAGG + Intronic
1081004326 11:37715567-37715589 TTCCTCCAGTCTATCTCCAAAGG - Intergenic
1081871341 11:46383979-46384001 TTCTTCCAGGGCCCCTGAAAGGG + Intergenic
1082259658 11:50068876-50068898 TTCCAGCAGAGCATCTCAAAGGG - Intergenic
1086527907 11:87750615-87750637 TTTCTCCAGTGCCCATCACAAGG + Intergenic
1095164591 12:38956787-38956809 TTCCTCAAGTGGACCTCAAATGG + Intergenic
1101593201 12:106140297-106140319 TTCCACCAGTGGACCTCACTGGG + Intergenic
1103412022 12:120719125-120719147 TTCCTCCAGGGGACTCCAAATGG + Intronic
1105744694 13:23366309-23366331 TTCACCCAGTGCATCCCAAAGGG + Intronic
1106419342 13:29572513-29572535 TTCCTCCCCTGCCCCTCACATGG - Intronic
1107278700 13:38708266-38708288 TTCTTCCAGTGCAATTCTAATGG + Intronic
1114355322 14:21901629-21901651 TTCTTCCAGTGCAGAGCAAAAGG + Intergenic
1116604678 14:46975052-46975074 TTTCTCCAGTGATACTCAAATGG + Intronic
1118614007 14:67562818-67562840 TTCCTCCAGCTCAGCTCCAAGGG - Exonic
1120792692 14:88599681-88599703 CTCCTCCATTCCTCCTCAAAAGG + Intronic
1202858371 14_GL000225v1_random:64998-65020 GGGCTCCCGTGCACCTCAAACGG + Intergenic
1123784891 15:23661673-23661695 TTCCTTGAGTGCACATCAATGGG - Intergenic
1126344160 15:47675432-47675454 TTCCTGCTGTGCCCCTCACAGGG - Intronic
1127948080 15:63775588-63775610 TTCCACCAGTGAAGCTGAAATGG - Exonic
1128910217 15:71507163-71507185 TTCCTCCTGTACACCTGTAATGG + Intronic
1129907694 15:79200800-79200822 TCCCTCCAGGGCTCCTCAACTGG + Intergenic
1133918690 16:10132432-10132454 TGTCTCCAGTGCACCTAAACAGG + Intronic
1136588158 16:31201295-31201317 CTCCTCCAGTGCTCCCTAAAGGG - Intergenic
1137546617 16:49409094-49409116 TTCCACCAGTCCAGCTCAACAGG - Intergenic
1137632231 16:49955066-49955088 ATCCTTCAGGGCACCCCAAAGGG + Intergenic
1140379717 16:74475470-74475492 TAACTCCAGTACACATCAAAAGG + Intronic
1143897155 17:10145244-10145266 ATGCTCAAGTGCACATCAAAAGG + Intronic
1144303207 17:13943068-13943090 TTCCTCCAGTGCAGGAGAAAGGG + Intergenic
1146690521 17:34871887-34871909 TTTCTCCAGAGAAACTCAAAGGG - Intergenic
1155495654 18:26439332-26439354 TTCCTCCACTGCACCATAAATGG - Intergenic
1155517364 18:26637046-26637068 TCCCTCCAGAGCACCTCGGAGGG + Intronic
1158350380 18:56559146-56559168 TTTCTCATGTGCATCTCAAATGG + Intergenic
1158548298 18:58414337-58414359 TGCCTCCAGCTCACATCAAAAGG + Intergenic
1160544668 18:79645008-79645030 ATCTTCCCCTGCACCTCAAATGG + Intergenic
1160895255 19:1399427-1399449 TCCCCCCAGTGCACATCAGAGGG + Intronic
1163690309 19:18735098-18735120 CTCCTCCTGTGCTCCTCCAAGGG - Intronic
1165875379 19:39002918-39002940 TTCCTGCCGTACATCTCAAAAGG + Intronic
925684812 2:6459386-6459408 TGCCTCCACTGTACCTCACAGGG - Intergenic
929044443 2:37776455-37776477 TTCATCCAGTGCCACTCAAAAGG + Intergenic
930725916 2:54681272-54681294 TTCCTCTAGAGCATCCCAAAAGG - Intergenic
933675759 2:85055969-85055991 TTCTTCCAGAGCACCTCGAGGGG - Exonic
935975190 2:108571245-108571267 TCCCTCCAGATAACCTCAAATGG - Intronic
943334024 2:186591551-186591573 TTCCTCCACTTCACCCCGAAGGG - Intronic
944666394 2:201962801-201962823 CTCCTCCAGTGCGCCACAAGAGG + Intergenic
946331810 2:219013776-219013798 TGACTCCAGGGCACCCCAAATGG - Intronic
946458811 2:219851410-219851432 TTCCTACTCTGCACCTCACAAGG - Intergenic
946959123 2:224964803-224964825 TTCGGCCACTGAACCTCAAAAGG + Intronic
946965057 2:225028438-225028460 TTCCTCTAGAGCTCCACAAAGGG + Intronic
1169021525 20:2334632-2334654 TTCTTCCACTGCCCCTCAGAAGG + Intronic
1169772583 20:9217917-9217939 TTCTTCCAGTGCTCCCCTAATGG + Intronic
1170713105 20:18809804-18809826 TTCTTCCATTGCACCTCGGAAGG - Exonic
1174667806 20:52276533-52276555 TTCCTCCAGTGCTTCTCAGTGGG + Intergenic
1175619917 20:60434773-60434795 CACCTCCAGTCCACCTCACATGG - Intergenic
1178278972 21:31264740-31264762 TTGCTCCAGTGCAAGTCAAATGG - Intronic
1181237173 22:21454643-21454665 TTACTGCAATCCACCTCAAATGG - Intergenic
1185004028 22:48264856-48264878 TGCCTCCAGGGCACCCCAAAAGG + Intergenic
949418236 3:3836640-3836662 TCCCTCCTATGCAGCTCAAATGG + Intronic
950192520 3:10987489-10987511 TACTTTCAGTGCCCCTCAAAAGG - Intergenic
951505362 3:23439243-23439265 TTCTTCCTGTGCACTGCAAAAGG + Intronic
951538910 3:23764159-23764181 TTCCTCCAGAAAACCTCATAGGG + Intergenic
954463857 3:50643231-50643253 TTCCTCCAGGGCTCAGCAAATGG - Intronic
954499820 3:51001333-51001355 TTCCTGCATTCCAACTCAAATGG + Intronic
954659522 3:52219511-52219533 TTTCTCCCCTGCTCCTCAAAGGG + Intergenic
958986716 3:100788494-100788516 TTCCTCAACTGTACCTCACAGGG + Intronic
961283437 3:125781252-125781274 TTCTTGCAGTTCACCCCAAAAGG - Intergenic
962896097 3:139716276-139716298 CTCTTCCAGAGCATCTCAAAGGG - Intergenic
962898003 3:139733328-139733350 TTCCGGCAGAGCACCTGAAATGG - Intergenic
962937629 3:140095494-140095516 TTCCTCCAGTTCTCCACTAATGG - Intronic
968054873 3:195683806-195683828 TTCCTCCAGTGCACCTCAAAGGG - Intergenic
968101037 3:195965466-195965488 TTCCTCCAGTGCTCCTCAAAGGG + Intergenic
970545204 4:17122330-17122352 ACCCTCCAGTGCCCCTCAGATGG + Intergenic
982119902 4:152132744-152132766 TTCCTCCTGTGCTCCTCCATAGG + Intergenic
983300460 4:165918880-165918902 TAGCTCCAGTGTACCTCAACTGG + Intronic
985502045 5:254447-254469 TTCCTCCAGTGCTCCTCAAAGGG - Exonic
985734973 5:1574219-1574241 TTCCTCCAGTGCTCCTCAAAGGG + Intergenic
986306665 5:6521615-6521637 CTGCTCCAGTGCACCTAGAAAGG + Intergenic
986413674 5:7507107-7507129 TTCTTCCAGTGCACATCGAAAGG + Intronic
990661969 5:58025880-58025902 TTCATGCAGTGCACCTCACTAGG - Intergenic
994723468 5:103407368-103407390 TTGCTCCAGAGCTCCCCAAAGGG - Intergenic
996273851 5:121640599-121640621 TTGGTGCAGTTCACCTCAAAGGG + Intergenic
997579147 5:135006270-135006292 TTCCTCCACTGCTGCTCTAAAGG + Intronic
997580338 5:135012956-135012978 TTCCCCCACAGCACCTCAACAGG - Intergenic
997869038 5:137490583-137490605 TGCCTCCAGCTCACCTCAAGAGG - Intronic
998541220 5:142983105-142983127 CTACTCCAGTGCATCTGAAATGG + Intronic
998848103 5:146330587-146330609 TCACTCCAGTTCACCCCAAATGG + Intronic
1003414812 6:5898320-5898342 TTCATCCAGTCTTCCTCAAAGGG - Intergenic
1003868900 6:10386115-10386137 TTGCTGCATTGCATCTCAAATGG + Intergenic
1005707875 6:28474132-28474154 TTCCTCCTGTTCTCTTCAAAAGG + Intergenic
1007336341 6:41157588-41157610 TTCTTCAAGTGTTCCTCAAATGG + Intergenic
1007914438 6:45547768-45547790 TCCCTTTAGTGCACCTCAACTGG - Exonic
1015059209 6:128942413-128942435 TTCTTCCAGTTGAGCTCAAAAGG + Intronic
1018428009 6:163700579-163700601 TTCCTCCACTCCCTCTCAAAAGG - Intergenic
1020396072 7:7720010-7720032 TTCTTCCAGTGTACCTCAGAGGG + Intronic
1020592266 7:10155431-10155453 TTCATCCAGTGCACCACTGACGG - Intergenic
1020732439 7:11898526-11898548 TTCCTCCAGGGCTCATCACATGG + Intergenic
1021883697 7:25117720-25117742 TTCATCCTCAGCACCTCAAAAGG - Intergenic
1023175780 7:37434098-37434120 TTCTTTCAGTGCACCCAAAATGG - Intronic
1023200772 7:37694545-37694567 TTCCTTCATTGCAACACAAATGG - Intronic
1025175526 7:56799462-56799484 TTCCAGCAGAGCATCTCAAAGGG - Intergenic
1025696273 7:63776958-63776980 TTCCAGCAGAGCATCTCAAAGGG + Intergenic
1025913157 7:65843865-65843887 TTCCAGCAGAGCATCTCAAAGGG + Intergenic
1028439724 7:90846215-90846237 TTCCTCCAGAGCAGCTCATGTGG + Intronic
1031627311 7:124005397-124005419 CACCTCCAGTGCACCTCACAAGG - Intergenic
1036142237 8:6219068-6219090 TTCCTCCAGTCTTCCCCAAAGGG + Intergenic
1037755987 8:21710347-21710369 TTCCTGCTGTGCACTTCAAGTGG - Intronic
1038350444 8:26771493-26771515 TTCCTGCCGTGCACATCAACGGG - Intronic
1042797457 8:72680197-72680219 TTCCTTTAGGGTACCTCAAATGG - Intronic
1053382520 9:37660441-37660463 TTCTTCCAGTGCAGCTCCATCGG - Intronic
1057479772 9:95435629-95435651 TTCTTCCAGTGCACCTTACATGG + Intergenic
1057859529 9:98628833-98628855 TTCCTCCCGTGAAGCTGAAAAGG + Intronic
1059282748 9:113148951-113148973 TTCCTCTACTGAACCTCAGAAGG + Intergenic
1203449609 Un_GL000219v1:99742-99764 ATCCTCAAGTGCTCCTCAAGAGG - Intergenic
1186436970 X:9551278-9551300 TTCCTCCACTCTACCCCAAAAGG - Intronic
1187346218 X:18466916-18466938 TTCCTGCAGTGCATCTCTATTGG - Intronic
1191046811 X:56147035-56147057 TTCCACCAGGCCACCTAAAATGG - Intergenic
1191117515 X:56867028-56867050 TTCCTGCAATGCACTGCAAAGGG + Intergenic
1191136170 X:57067549-57067571 TCCATCCAGTGCTCCACAAAAGG - Intergenic
1195369146 X:104156129-104156151 GTTCTCCAGTTCACCTCAACAGG + Intronic