ID: 968054874

View in Genome Browser
Species Human (GRCh38)
Location 3:195683807-195683829
Sequence CTTCCTCCAGTGCACCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 3, 2: 1, 3: 12, 4: 151}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054874_968054879 9 Left 968054874 3:195683807-195683829 CCTTTGAGGTGCACTGGAGGAAG 0: 1
1: 3
2: 1
3: 12
4: 151
Right 968054879 3:195683839-195683861 TCCTATGTGGACGTCGGCACTGG 0: 1
1: 3
2: 0
3: 0
4: 31
968054874_968054882 14 Left 968054874 3:195683807-195683829 CCTTTGAGGTGCACTGGAGGAAG 0: 1
1: 3
2: 1
3: 12
4: 151
Right 968054882 3:195683844-195683866 TGTGGACGTCGGCACTGGGAAGG 0: 1
1: 3
2: 1
3: 2
4: 100
968054874_968054876 3 Left 968054874 3:195683807-195683829 CCTTTGAGGTGCACTGGAGGAAG 0: 1
1: 3
2: 1
3: 12
4: 151
Right 968054876 3:195683833-195683855 ACCCTGTCCTATGTGGACGTCGG No data
968054874_968054875 -4 Left 968054874 3:195683807-195683829 CCTTTGAGGTGCACTGGAGGAAG 0: 1
1: 3
2: 1
3: 12
4: 151
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data
968054874_968054881 10 Left 968054874 3:195683807-195683829 CCTTTGAGGTGCACTGGAGGAAG 0: 1
1: 3
2: 1
3: 12
4: 151
Right 968054881 3:195683840-195683862 CCTATGTGGACGTCGGCACTGGG 0: 1
1: 3
2: 0
3: 4
4: 28
968054874_968054883 23 Left 968054874 3:195683807-195683829 CCTTTGAGGTGCACTGGAGGAAG 0: 1
1: 3
2: 1
3: 12
4: 151
Right 968054883 3:195683853-195683875 CGGCACTGGGAAGGTCAGTGTGG 0: 1
1: 3
2: 1
3: 17
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054874 Original CRISPR CTTCCTCCAGTGCACCTCAA AGG (reversed) Intergenic
902208671 1:14888779-14888801 CATTATCCAGTGCAGCTCAATGG + Intronic
902829972 1:19006088-19006110 GTTCCTCCACTGCAGCTCACAGG + Intergenic
904061384 1:27713615-27713637 CTTCCCTTAGTGCACCTGAAGGG - Intergenic
904595324 1:31640912-31640934 CCTCCTCCTGTGCACTTGAAGGG - Intronic
905555068 1:38876059-38876081 CTTCCTCCAGAGTATCTCCAAGG + Exonic
911058575 1:93728657-93728679 CTTCTTCCAGTGCTGGTCAATGG + Intronic
913508058 1:119537262-119537284 CTTCCCCCAATCCACCTCATAGG - Intergenic
919532542 1:198742008-198742030 CTACCTGCAGTGCACCACAATGG - Exonic
919929639 1:202213097-202213119 CTTTCTCCAGTGCTCATCCAGGG + Intronic
1064715226 10:18170045-18170067 CATACTGCAGTGCACCTCATTGG + Intronic
1067849560 10:49746074-49746096 ATTCCTCCTGGGCACCTCAGTGG - Intronic
1070359035 10:75669303-75669325 CTTCCCCCAGAGAACCTCATAGG - Intronic
1070502234 10:77082911-77082933 ATTCCTCCAGTGCATTTCAGAGG - Intronic
1071336418 10:84604113-84604135 CCTCCCCCACTGCACCTGAAGGG - Intergenic
1078185958 11:9052440-9052462 TGTACTCCAGAGCACCTCAAAGG - Intronic
1079603732 11:22341587-22341609 CTTCCTCTCGGGCACCTCTAGGG - Exonic
1080319378 11:30988634-30988656 CTTCCTCCAATGCAGCCCAGGGG - Intronic
1080623123 11:34004224-34004246 CTTCCTGCGCTGGACCTCAAAGG - Intergenic
1082259659 11:50068877-50068899 CTTCCAGCAGAGCATCTCAAAGG - Intergenic
1088908155 11:114170308-114170330 CTTCCTCCATTGGCCCTCCAGGG - Intronic
1089807118 11:121100612-121100634 CTGCCTCCAGTGACCCTCACTGG + Intergenic
1091902816 12:4158476-4158498 CTTCCTCTATTGGACCTCACTGG + Intergenic
1095407159 12:41879512-41879534 CTACCTCCAGTGCACCTAAGTGG + Intergenic
1096484591 12:51970049-51970071 CTTCCTGCAGTTCATCTCCAGGG - Intronic
1097660496 12:62425185-62425207 CTTCATCCAGTTTACCCCAATGG - Intergenic
1098854873 12:75641220-75641242 CTTGCTACAGTTCACCTCCACGG + Intergenic
1101066293 12:101025037-101025059 CTTCCTAAAATACACCTCAAAGG - Intronic
1101593200 12:106140296-106140318 TTTCCACCAGTGGACCTCACTGG + Intergenic
1102213354 12:111143230-111143252 CTTCATCCAGTGCAGCTCCTTGG - Intronic
1102261966 12:111448333-111448355 CTTCTGCCTGTGCTCCTCAAGGG - Exonic
1106850333 13:33783001-33783023 CTTCCCCCAAAACACCTCAATGG - Intergenic
1107660194 13:42631309-42631331 CTTCCTCCAGGGCCCCTTCATGG + Intergenic
1109876307 13:68408286-68408308 TTCCCTCTAGTGAACCTCAAAGG + Intergenic
1116665316 14:47766959-47766981 CTTCTTCCAGTGTACTTCAGGGG + Intergenic
1118614008 14:67562819-67562841 CTTCCTCCAGCTCAGCTCCAAGG - Exonic
1121666854 14:95679064-95679086 CTTCTTCCAGTGTAACTGAAAGG - Intergenic
1123784892 15:23661674-23661696 CTTCCTTGAGTGCACATCAATGG - Intergenic
1124813422 15:32964874-32964896 CCTCCTCCATTGCACCTCATGGG + Intronic
1124882997 15:33659437-33659459 CTTCCTCCAGTGCACAGGACAGG - Intronic
1127391584 15:58509251-58509273 CTTTCTCCACTCCACCTCCAGGG + Intronic
1127544520 15:59978673-59978695 CTTTCTCAAGAGAACCTCAAAGG + Intergenic
1128515843 15:68341453-68341475 CTTCCCCCTCTGAACCTCAACGG - Intronic
1129176594 15:73844602-73844624 CTTGCTCCAGTGCAGCTGACTGG - Intergenic
1130790885 15:87154899-87154921 CTTCCTTTAGTTCACCTTAATGG - Intergenic
1131518542 15:93095992-93096014 CTACCCACAGGGCACCTCAAGGG - Intergenic
1133140071 16:3737129-3737151 CTTCCTCCTGTGCACTGTAAAGG + Intronic
1135171413 16:20187214-20187236 CTTCCTTCAGGGCACTGCAAGGG + Intergenic
1135564661 16:23502577-23502599 CATTTTCCAGTGCACCTCAGTGG + Intronic
1136115486 16:28091780-28091802 CTTCCTCGAGTGCCCTTCAGAGG + Intergenic
1136615241 16:31394414-31394436 CTTCCTCCAGGACACCTCCCTGG - Intronic
1136905068 16:34081891-34081913 CTTCTTCCAATGCACATGAATGG + Intergenic
1138048933 16:53755421-53755443 ATCCCTCAAGTACACCTCAATGG - Intronic
1140019066 16:71219602-71219624 TTTCCTCCATACCACCTCAAGGG + Intronic
1142921368 17:3190041-3190063 CTTCCGTTAGTGCACCTGAAGGG + Intergenic
1147154070 17:38534401-38534423 CTTAATCCAGTGGATCTCAAAGG - Intronic
1147431163 17:40371632-40371654 CTTCCTCCAGAGCAGCTAATGGG - Intergenic
1147518257 17:41142664-41142686 CTTCCTCCATTGCACTTCTGTGG - Intergenic
1147650259 17:42058058-42058080 CCTCCTCCTGTGCCCCTCCAAGG + Intronic
1151405565 17:73883944-73883966 CTTCCTCTAGGGCACCTCCAAGG + Intergenic
1153378644 18:4411032-4411054 CTTACTCCAGAGCACCTCACGGG + Intronic
1153759530 18:8317229-8317251 CTACCTTCAATGCAGCTCAAGGG - Intronic
1155517363 18:26637045-26637067 CTCCCTCCAGAGCACCTCGGAGG + Intronic
1156731426 18:40197875-40197897 CTTCCCTAAGTGCACCTAAAAGG + Intergenic
1158609377 18:58924641-58924663 CTTCATCCAGTTCCCCACAATGG + Intronic
1160474191 18:79167746-79167768 CTTCCGGCAGTGGACCTCACTGG + Intronic
1163690310 19:18735099-18735121 CCTCCTCCTGTGCTCCTCCAAGG - Intronic
1164582853 19:29445548-29445570 CTTCCTCCAGTGACCCTGCAAGG - Intergenic
1166417263 19:42604932-42604954 CTTCTTCCAGTCCACTGCAATGG - Intronic
926639973 2:15224734-15224756 CTTCCTCCAGTGGCCTTCAGAGG - Intronic
929087497 2:38182947-38182969 CATCCACCTGTGCACCTCACCGG + Intergenic
931364942 2:61611244-61611266 CTTCCACCAGTGCATCCCATTGG - Intergenic
932595855 2:73093055-73093077 CATTCTCCAGTGGACCTCCATGG - Intronic
933675760 2:85055970-85055992 CTTCTTCCAGAGCACCTCGAGGG - Exonic
936524094 2:113231270-113231292 CTGCCTCCAGCTCAGCTCAAAGG - Intronic
940800862 2:158131148-158131170 CCTCCCCCATTGCTCCTCAAGGG - Intronic
945830606 2:214780064-214780086 GCTCCTCCAGTTCACCACAAAGG - Intronic
947567346 2:231202869-231202891 CTTCCCTTAGTGCACCTGAAGGG - Intronic
947925697 2:233920750-233920772 CTTCACCCAGTTCCCCTCAATGG + Intronic
948027011 2:234786368-234786390 TTTCCTCCAGTGCACCTTTTTGG + Intergenic
948351879 2:237347574-237347596 CTTCCTCCAACTCACCTCCAGGG - Intronic
1169554093 20:6731395-6731417 TTTCATCCAGTGCACCTCAATGG - Intergenic
1170521488 20:17190301-17190323 CTTCCTCCTGAGCCCTTCAATGG - Intergenic
1174667805 20:52276532-52276554 TTTCCTCCAGTGCTTCTCAGTGG + Intergenic
1177950420 21:27529078-27529100 CTGCCACCATAGCACCTCAATGG + Intergenic
1179591860 21:42414397-42414419 CCTCCCCCAGTGAACCTCATTGG + Intronic
1181409207 22:22706393-22706415 CTTCCACCAGTGCCTCTCCATGG - Intergenic
1184636399 22:45835372-45835394 CTTCCTCCACTGCACCCCGTGGG - Intronic
1184898796 22:47430809-47430831 CTTCCTCCAGTGCTTCTCATTGG - Intergenic
1185249196 22:49790872-49790894 CTTCCACACGTGCACTTCAAGGG + Intronic
1185413739 22:50698680-50698702 CTTCCTCCAGTGCTCAGCATTGG + Intergenic
950833527 3:15898299-15898321 TTTACTCCAGGCCACCTCAAAGG + Intergenic
952024073 3:29057630-29057652 CTGCCTCCACTGCATCACAAAGG - Intergenic
952251550 3:31661152-31661174 TTTCCTCAAGTGCACCTCTCTGG - Exonic
953593439 3:44283476-44283498 CTTCCTCTTGTGCACCAAAATGG - Intronic
954847690 3:53574246-53574268 CTTCCTCCAGTGCAGAGGAAGGG - Intronic
955337232 3:58096843-58096865 GCTCCTCCAGAGCACCTCCAAGG - Intronic
955527077 3:59832073-59832095 CTCCCTACAGTGCACATCATGGG - Intronic
955956377 3:64293936-64293958 TTTCCTTCAGGGCACCTCATTGG - Intronic
956264854 3:67385375-67385397 CATCCCCCAGTGCACATCACAGG - Intronic
956985718 3:74697556-74697578 CTTCCTCCAAAAAACCTCAAAGG + Intergenic
958551695 3:95622012-95622034 CTTCTTCCCGTAGACCTCAATGG + Intergenic
958986715 3:100788493-100788515 CTTCCTCAACTGTACCTCACAGG + Intronic
960008175 3:112803471-112803493 CTTCCTGCTGTGTAACTCAAAGG - Intronic
961861012 3:129916807-129916829 CTACCTCCAATGCACCTACAGGG + Intergenic
962968839 3:140380268-140380290 CTTCCACCAGGGCCCCACAATGG - Intronic
962974323 3:140433066-140433088 TTTCCTACAATGCATCTCAAAGG + Intronic
964014098 3:151925695-151925717 CTTCCTCCAGGGGGTCTCAATGG + Intergenic
964477300 3:157108729-157108751 CTTCCTCCGGTGAACCTCCCAGG + Intergenic
964675655 3:159277125-159277147 CTGACTCCTGTGCACCACAATGG + Intronic
967135810 3:186511737-186511759 CTTCATCCCGTGGAGCTCAAGGG + Intergenic
968054874 3:195683807-195683829 CTTCCTCCAGTGCACCTCAAAGG - Intergenic
968101036 3:195965465-195965487 CTTCCTCCAGTGCTCCTCAAAGG + Intergenic
969849800 4:9947324-9947346 CTCTCTCCATTGCAGCTCAAGGG + Intronic
972325807 4:38014388-38014410 CCTCCTCCAGTGCTCCGCAGTGG + Intronic
975516279 4:75251791-75251813 CCTCTCCCAGTGCACCTCATTGG + Intergenic
976371677 4:84296330-84296352 CTTCTACCAGTTCACATCAATGG + Intergenic
977709676 4:100110770-100110792 CTTCCTCCAGTCCTCCTCTGTGG - Intergenic
980086314 4:128393903-128393925 CTTCCTCCATGGGAACTCAAAGG + Intergenic
982915879 4:161208644-161208666 CTTCATTCAGTGCACATGAAAGG - Intergenic
985502046 5:254448-254470 CTTCCTCCAGTGCTCCTCAAAGG - Exonic
985734972 5:1574218-1574240 CTTCCTCCAGTGCTCCTCAAAGG + Intergenic
987179078 5:15347606-15347628 CTACCTCCAGTGCATCAGAATGG + Intergenic
988042771 5:25910403-25910425 CTTCATCTGCTGCACCTCAATGG - Intergenic
992379441 5:76222650-76222672 CTTCATCCAGTTTCCCTCAATGG - Intronic
996273850 5:121640598-121640620 CTTGGTGCAGTTCACCTCAAAGG + Intergenic
997206024 5:132050667-132050689 CTTCCTCCAGGGCACTTCTTTGG - Intergenic
997611368 5:135218053-135218075 TTTCCTCCTGCCCACCTCAAAGG + Intronic
997816063 5:137018295-137018317 CTTCCTCCAGGTCACCTGACTGG - Intronic
998625433 5:143840722-143840744 CTTCCTCATGTGGACCTCAGAGG + Intergenic
998932074 5:147192313-147192335 CATACTACAGTGCTCCTCAAAGG + Intergenic
1001213459 5:169832993-169833015 CTTCCTCCAGTCCAGCACACAGG - Intronic
1006618554 6:35346274-35346296 CTTGCTCCAGTGCCTCTGAAGGG + Intronic
1006673549 6:35745675-35745697 CTTCACCCAGTTCCCCTCAATGG - Intronic
1008492690 6:52102639-52102661 CTTCCCCCAGAGCAGCACAAAGG + Intergenic
1012558818 6:100552644-100552666 CTCTTTCCAGTGCACCTCAGTGG + Intronic
1014385053 6:120790213-120790235 CTCCCTCCACTGCACCTCACAGG - Intergenic
1015330187 6:131968832-131968854 CTTCCTCCAGAGCACATGGACGG - Intergenic
1018061328 6:160092111-160092133 CTACCTCCAGTGCCCCTCCTGGG + Intronic
1018061347 6:160092191-160092213 CTACCTCCAGTGCCCCTCCTGGG + Intronic
1018061366 6:160092271-160092293 CTACCTCCAGTGCCCCTCCTGGG + Intronic
1018623212 6:165751484-165751506 CTTCATCAAGGGCACCCCAAGGG - Intronic
1018857633 6:167685899-167685921 CCTGCCCCAGTGCACCTCACCGG + Intergenic
1019083700 6:169454824-169454846 CTTCCTCCCCTGCACATCCATGG + Intergenic
1020396071 7:7720009-7720031 CTTCTTCCAGTGTACCTCAGAGG + Intronic
1022813808 7:33894798-33894820 ATTCCTGAAGTGCCCCTCAAGGG - Intergenic
1022942740 7:35255553-35255575 CTCCCCCCAGTCCACCTCAGCGG + Intergenic
1024558743 7:50626457-50626479 CTCTCTCCAGAGCACCTCAAGGG + Intronic
1025175527 7:56799463-56799485 CTTCCAGCAGAGCATCTCAAAGG - Intergenic
1025696272 7:63776957-63776979 CTTCCAGCAGAGCATCTCAAAGG + Intergenic
1025913156 7:65843864-65843886 CTTCCAGCAGAGCATCTCAAAGG + Intergenic
1033290615 7:140079633-140079655 GTTCCTGCAGTCCACCTGAATGG - Intergenic
1034568162 7:151932423-151932445 CTCTCTCCAGTGCAGCTCACAGG - Intergenic
1035071698 7:156149496-156149518 CTTCCTCCAGGGCTCACCAATGG + Intergenic
1038350445 8:26771494-26771516 GTTCCTGCCGTGCACATCAACGG - Intronic
1042507556 8:69577152-69577174 GCTCCTCCCGTGCATCTCAAGGG + Intronic
1043847514 8:85178794-85178816 CCTCCTCCAGTGTAGCCCAAGGG + Intronic
1044572422 8:93734524-93734546 CCGCCTCCAGTCCTCCTCAAGGG + Exonic
1047409908 8:124615870-124615892 CTTCCTCCTGTGATCCTGAACGG - Intronic
1047952510 8:129946796-129946818 CTTCCTGCAGGTCACCTGAAGGG - Intronic
1048918382 8:139205241-139205263 CTTCCTCAAGGGAAGCTCAAGGG - Intergenic
1055327901 9:75151037-75151059 CTTCCTCCACTGCACAGCTAGGG - Intergenic
1056357361 9:85815054-85815076 CCTCATCCAGTGCTCCTCAGTGG - Intergenic
1056729519 9:89153637-89153659 CAACCTCCTGTCCACCTCAAGGG + Intronic
1191117514 X:56867027-56867049 CTTCCTGCAATGCACTGCAAAGG + Intergenic
1191720498 X:64224729-64224751 TTTTCTCCAGTGCACCTCAGAGG + Intronic
1191869667 X:65735367-65735389 CTTCATCTGCTGCACCTCAATGG - Exonic
1198326633 X:135580242-135580264 TTGCCCCCAGTGTACCTCAAGGG - Intronic
1201302961 Y:12526036-12526058 TCTCCTCCAGTGCAGCTCGAGGG - Intergenic