ID: 968054875

View in Genome Browser
Species Human (GRCh38)
Location 3:195683826-195683848
Sequence GAAGCACACCCTGTCCTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054867_968054875 21 Left 968054867 3:195683782-195683804 CCCATCCAGGGGCAACAGAAGAA No data
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data
968054868_968054875 20 Left 968054868 3:195683783-195683805 CCATCCAGGGGCAACAGAAGAAG No data
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data
968054874_968054875 -4 Left 968054874 3:195683807-195683829 CCTTTGAGGTGCACTGGAGGAAG 0: 1
1: 3
2: 1
3: 12
4: 151
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data
968054866_968054875 26 Left 968054866 3:195683777-195683799 CCAAGCCCATCCAGGGGCAACAG No data
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data
968054873_968054875 -3 Left 968054873 3:195683806-195683828 CCCTTTGAGGTGCACTGGAGGAA 0: 1
1: 3
2: 1
3: 9
4: 125
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data
968054869_968054875 16 Left 968054869 3:195683787-195683809 CCAGGGGCAACAGAAGAAGCCCT No data
Right 968054875 3:195683826-195683848 GAAGCACACCCTGTCCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054875 Original CRISPR GAAGCACACCCTGTCCTATG TGG Intergenic
No off target data available for this crispr