ID: 968054879

View in Genome Browser
Species Human (GRCh38)
Location 3:195683839-195683861
Sequence TCCTATGTGGACGTCGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 3, 2: 0, 3: 0, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054874_968054879 9 Left 968054874 3:195683807-195683829 CCTTTGAGGTGCACTGGAGGAAG 0: 1
1: 3
2: 1
3: 12
4: 151
Right 968054879 3:195683839-195683861 TCCTATGTGGACGTCGGCACTGG 0: 1
1: 3
2: 0
3: 0
4: 31
968054869_968054879 29 Left 968054869 3:195683787-195683809 CCAGGGGCAACAGAAGAAGCCCT No data
Right 968054879 3:195683839-195683861 TCCTATGTGGACGTCGGCACTGG 0: 1
1: 3
2: 0
3: 0
4: 31
968054873_968054879 10 Left 968054873 3:195683806-195683828 CCCTTTGAGGTGCACTGGAGGAA 0: 1
1: 3
2: 1
3: 9
4: 125
Right 968054879 3:195683839-195683861 TCCTATGTGGACGTCGGCACTGG 0: 1
1: 3
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054879 Original CRISPR TCCTATGTGGACGTCGGCAC TGG Intergenic
900652518 1:3736925-3736947 TCCTTGGTGGACGTGGGGACAGG - Intergenic
903187148 1:21635135-21635157 TCCTGCGTGGACGTGGGCAGGGG - Intronic
1073639052 10:105230689-105230711 TGCTATGTGGACTAAGGCACAGG - Intronic
1073822869 10:107285240-107285262 TCCCATGAGGACTTCAGCACAGG - Intergenic
1073999139 10:109350781-109350803 ACCATTGTGGACGTCGGCATTGG - Intergenic
1078013337 11:7591321-7591343 GTCCATGTGGACTTCGGCACTGG + Intronic
1078492380 11:11781444-11781466 TCCTATGTGCACCACTGCACAGG - Intergenic
1103184756 12:118946729-118946751 TCCATTTTGGACGTCGGCCCAGG - Intergenic
1108955879 13:56156322-56156344 TGCTATGTGGACTCAGGCACAGG - Intergenic
1113338973 13:109403771-109403793 TCCTAGGTAGACCTGGGCACCGG - Intergenic
1113885193 13:113655157-113655179 GCCTATGTGGACGTCCAGACGGG - Intronic
1123122915 14:105926421-105926443 TGCTCTGTGCACGCCGGCACAGG - Intronic
1129869800 15:78932993-78933015 GCCTAAGTGGAGGTCAGCACTGG - Intronic
1133924301 16:10181424-10181446 TCCTAGGTGCACGTGGGCAGTGG + Intronic
1134297765 16:12961996-12962018 TCTGATGTTGACGTCGCCACAGG - Intronic
1154402674 18:14056589-14056611 TCCTCTGTGGACCTGGGCCCTGG + Intergenic
1156281820 18:35646526-35646548 TACTATGTGGACCTCTGCATAGG + Intronic
1160513368 18:79465295-79465317 GCCTATGTTGATGTGGGCACAGG - Intronic
928456418 2:31426836-31426858 TCCCATGTGGAAGTAGGAACTGG + Intergenic
1173008206 20:39157311-39157333 ACCTCTGTGGACATTGGCACTGG + Intergenic
1182718938 22:32382170-32382192 TCCTTTCTGCACGTCTGCACTGG - Intergenic
1183476923 22:38040748-38040770 TCCTTTGTGAACGAGGGCACTGG + Intronic
968054879 3:195683839-195683861 TCCTATGTGGACGTCGGCACTGG + Intergenic
968101032 3:195965433-195965455 TCCTATGTGGACGTCAGCACTGG - Intergenic
970074095 4:12197594-12197616 TCCTATGAGGAAGGAGGCACAGG + Intergenic
985502051 5:254480-254502 TCCTATGTGGACGTTGGCACTGG + Exonic
985734967 5:1574186-1574208 TCCTATGTGGACGTTGGCACTGG - Intergenic
1007289326 6:40773354-40773376 TCTTATGTGGATGGTGGCACAGG + Intergenic
1020002409 7:4763378-4763400 CCCCATGTGGCCGTCAGCACCGG - Exonic
1022254778 7:28645022-28645044 TCCTATCTTGACAACGGCACTGG - Intronic
1025744297 7:64229436-64229458 TCGTATGTGGATGTGGCCACAGG - Intronic
1037703712 8:21297619-21297641 TCCTATGTGAACACCGTCACTGG + Intergenic
1047758651 8:127937950-127937972 GCCTGTGTGGAGGTCGACACTGG + Intergenic
1191846453 X:65551010-65551032 GCCTATGTGGAGGACGGCAAGGG - Intergenic
1197178702 X:123511503-123511525 TCATATGAGGACTTCAGCACTGG - Intergenic