ID: 968054881

View in Genome Browser
Species Human (GRCh38)
Location 3:195683840-195683862
Sequence CCTATGTGGACGTCGGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 3, 2: 0, 3: 4, 4: 28}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054873_968054881 11 Left 968054873 3:195683806-195683828 CCCTTTGAGGTGCACTGGAGGAA 0: 1
1: 3
2: 1
3: 9
4: 125
Right 968054881 3:195683840-195683862 CCTATGTGGACGTCGGCACTGGG 0: 1
1: 3
2: 0
3: 4
4: 28
968054869_968054881 30 Left 968054869 3:195683787-195683809 CCAGGGGCAACAGAAGAAGCCCT No data
Right 968054881 3:195683840-195683862 CCTATGTGGACGTCGGCACTGGG 0: 1
1: 3
2: 0
3: 4
4: 28
968054874_968054881 10 Left 968054874 3:195683807-195683829 CCTTTGAGGTGCACTGGAGGAAG 0: 1
1: 3
2: 1
3: 12
4: 151
Right 968054881 3:195683840-195683862 CCTATGTGGACGTCGGCACTGGG 0: 1
1: 3
2: 0
3: 4
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054881 Original CRISPR CCTATGTGGACGTCGGCACT GGG Intergenic
900289760 1:1918934-1918956 CCTGTGGGGACGGCGGCACCTGG + Exonic
904787400 1:32993093-32993115 CCTCTTTGGACCTCGGTACTGGG + Intergenic
909321117 1:74286610-74286632 CCCCTGTGGACTTAGGCACTAGG + Intronic
1069713104 10:70502773-70502795 CCCATGTGGGCATGGGCACTGGG - Intronic
1073999137 10:109350780-109350802 CCATTGTGGACGTCGGCATTGGG - Intergenic
1078013338 11:7591322-7591344 TCCATGTGGACTTCGGCACTGGG + Intronic
1086992893 11:93325190-93325212 CCTATTTTGACTTTGGCACTGGG + Intergenic
1095689893 12:45075769-45075791 CCTAAGTGTATGTCGTCACTAGG + Intergenic
1113418451 13:110150674-110150696 CCTATGGGGCTGTGGGCACTGGG - Intronic
1128683480 15:69667642-69667664 CCTCTCTGGACCTCAGCACTGGG + Intergenic
1129221681 15:74135013-74135035 CCTAGGTGGAGGTCGGGAATGGG - Exonic
1129869798 15:78932992-78933014 CCTAAGTGGAGGTCAGCACTGGG - Intronic
1133924303 16:10181425-10181447 CCTAGGTGCACGTGGGCAGTGGG + Intronic
1153340621 18:3970868-3970890 CCTATGGGGACCTCAGAACTAGG - Intronic
1165928443 19:39341936-39341958 CCTCAGTGGGCGTCTGCACTCGG - Intronic
928456420 2:31426837-31426859 CCCATGTGGAAGTAGGAACTGGG + Intergenic
933998446 2:87686847-87686869 CTTATGTGGAGGTGGGCGCTTGG - Intergenic
936295403 2:111264026-111264048 CTTATGTGGAGGTGGGCGCTTGG + Intergenic
944373185 2:199010951-199010973 ACTCTGTGGACTTAGGCACTAGG - Intergenic
1169017715 20:2305203-2305225 CCTCTGTGGACGTGGGTAGTGGG + Intronic
1173247307 20:41345546-41345568 CAGATGTGGACATCGGCACTTGG + Intronic
968054881 3:195683840-195683862 CCTATGTGGACGTCGGCACTGGG + Intergenic
968101030 3:195965432-195965454 CCTATGTGGACGTCAGCACTGGG - Intergenic
974351373 4:60751295-60751317 CCTATGTGGACCTGGTCCCTAGG + Intergenic
985126757 4:186702064-186702086 CCTGTGTGGAGGTCGGCTCCTGG - Intronic
985502053 5:254481-254503 CCTATGTGGACGTTGGCACTGGG + Exonic
985734965 5:1574185-1574207 CCTATGTGGACGTTGGCACTGGG - Intergenic
988429784 5:31106017-31106039 TCTCTCTGGACGTAGGCACTAGG + Intergenic
997356568 5:133266496-133266518 CCCATGTGGACGGCAGCCCTGGG - Intronic
1010580454 6:77590178-77590200 CCTATGTAAACCTCAGCACTTGG + Intergenic
1019430287 7:995986-996008 TCTATGTGGACATCGAGACTCGG - Intergenic
1020002407 7:4763377-4763399 CCCATGTGGCCGTCAGCACCGGG - Exonic
1022254776 7:28645021-28645043 CCTATCTTGACAACGGCACTGGG - Intronic
1023694209 7:42828157-42828179 CATATGTGGGTGTTGGCACTTGG - Intergenic
1035219428 7:157397058-157397080 CCGATGTGGACGTGTGCACGCGG + Intronic
1191846451 X:65551009-65551031 CCTATGTGGAGGACGGCAAGGGG - Intergenic