ID: 968054882

View in Genome Browser
Species Human (GRCh38)
Location 3:195683844-195683866
Sequence TGTGGACGTCGGCACTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 3, 2: 1, 3: 2, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054874_968054882 14 Left 968054874 3:195683807-195683829 CCTTTGAGGTGCACTGGAGGAAG 0: 1
1: 3
2: 1
3: 12
4: 151
Right 968054882 3:195683844-195683866 TGTGGACGTCGGCACTGGGAAGG 0: 1
1: 3
2: 1
3: 2
4: 100
968054873_968054882 15 Left 968054873 3:195683806-195683828 CCCTTTGAGGTGCACTGGAGGAA 0: 1
1: 3
2: 1
3: 9
4: 125
Right 968054882 3:195683844-195683866 TGTGGACGTCGGCACTGGGAAGG 0: 1
1: 3
2: 1
3: 2
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054882 Original CRISPR TGTGGACGTCGGCACTGGGA AGG Intergenic
901461849 1:9396830-9396852 TGTTGATGTCGGCTCTAGGAAGG - Intergenic
904876280 1:33656977-33656999 TGTGGAAGTGGGCACCTGGAGGG + Intronic
907708226 1:56851374-56851396 TGTGCATGCCTGCACTGGGATGG - Intergenic
908251365 1:62268542-62268564 TGTTGACATGGGCACTGGGCAGG - Intronic
923220540 1:231888768-231888790 TGTGGATGGGGGCACTGGGGTGG - Intronic
1067433742 10:46263354-46263376 AGTGGAAGGAGGCACTGGGAAGG - Intergenic
1067439945 10:46302954-46302976 AGTGGAAGGAGGCACTGGGAAGG + Intronic
1075898476 10:126018948-126018970 TGTGGAGGTGGGCATTGAGATGG + Intronic
1077139821 11:1019345-1019367 TGTGGACGTCGTGGCTGGGCTGG + Exonic
1077183107 11:1225081-1225103 TGTGGCCGTTGATACTGGGATGG - Intronic
1079906667 11:26256699-26256721 TGTGTACGTTGTCACAGGGATGG - Intergenic
1080838690 11:35964481-35964503 TTGGGACATAGGCACTGGGAAGG + Intronic
1083267811 11:61555093-61555115 TGTGGCTGTGGGCACTGGGTGGG - Intronic
1084103204 11:66963717-66963739 TGTGGGCGTCAGCCCTGGTATGG + Intergenic
1084482295 11:69428973-69428995 TGTGGACCCTGGCCCTGGGAAGG + Intergenic
1091007582 11:131967462-131967484 TGTGTAGGTTGGCCCTGGGAAGG + Intronic
1097760001 12:63452777-63452799 TGTGAACATACGCACTGGGAAGG - Intergenic
1101826543 12:108224839-108224861 CGTGGACTTCTGCACTGAGAAGG + Exonic
1102198548 12:111041822-111041844 TCTGGAACTAGGCACTGGGAAGG - Intronic
1106705902 13:32279243-32279265 TGGGGAGGGCGGCTCTGGGAAGG + Intronic
1113679537 13:112233570-112233592 TGTGGAGGTCAGAGCTGGGAGGG - Intergenic
1118817486 14:69323507-69323529 CCTGGAGGTCAGCACTGGGAGGG + Intronic
1119318871 14:73717858-73717880 TGTGGATATCGACACTGGGTAGG + Exonic
1124277062 15:28334837-28334859 TGTGGAGGTGGGCTCGGGGAAGG + Intergenic
1124305638 15:28576769-28576791 TGTGGAGGTGGGCTCGGGGAAGG - Intergenic
1124426735 15:29569882-29569904 TGTGGGCGACGGGACTGGGCAGG - Intronic
1127632804 15:60842157-60842179 AGTGGACGACGGCCCTGGGGTGG - Intronic
1127965164 15:63917783-63917805 TGGGGACGGCGTCCCTGGGAAGG + Intronic
1132507289 16:317462-317484 CGTGGACATCGGCCCTGGCAGGG - Intronic
1132870568 16:2114038-2114060 TGGGGACGTCGGCCCCGGGCAGG - Intronic
1134136947 16:11683318-11683340 TGTGAACGTCCGCCATGGGATGG - Intronic
1134521964 16:14922866-14922888 TGGGGACGTCGGCCCCGGGCAGG + Intronic
1134709634 16:16321517-16321539 TGGGGACGTCGGCCCCGGGCAGG + Intergenic
1134716847 16:16361546-16361568 TGGGGACGTCGGCCCCGGGCAGG + Intergenic
1134949969 16:18347128-18347150 TGGGGACGTCGGCCCCGGGCAGG - Intergenic
1134957905 16:18390613-18390635 TGGGGACGTCGGCCCCGGGCAGG - Intergenic
1136695707 16:32079140-32079162 TGGGGTCGTCGGAGCTGGGAGGG + Intergenic
1140003902 16:71055949-71055971 TGGGGACCTCAGCACTGGGCTGG - Intronic
1141042574 16:80684658-80684680 TGGGGACGCCGGCTCTGAGAAGG - Exonic
1142178158 16:88654507-88654529 TGTGGACGTGGGCTGTGGGATGG + Intronic
1146944999 17:36867521-36867543 TGGGGAAGTAGGGACTGGGAAGG - Intergenic
1147911681 17:43859775-43859797 GGTGGATGAGGGCACTGGGAGGG - Intronic
1150004884 17:61463381-61463403 TGTGGGCGTCGGCACAGGGAAGG - Intronic
1151898970 17:76999135-76999157 TCTGGAGGTCGGCACTGATACGG - Intergenic
1152657478 17:81526768-81526790 TGTGGGCATCGTCTCTGGGAAGG + Intergenic
1153885650 18:9462992-9463014 AGTGGATGTTGGCATTGGGAAGG + Intergenic
1156450461 18:37263632-37263654 TGGGTACCTAGGCACTGGGATGG + Intronic
1156450783 18:37265535-37265557 TGTGGACTTGGCCTCTGGGAAGG + Intronic
1157520508 18:48342152-48342174 TGTGCTCCTGGGCACTGGGAGGG - Intronic
1159022499 18:63155167-63155189 GGTGGAGGTCGGCACAGGGCGGG + Intronic
1160059664 18:75517577-75517599 TGTGGATGTGGGCACAGGCAGGG + Intergenic
937702668 2:124881648-124881670 TGTGGACATCGCCACAGTGAAGG - Intronic
946741894 2:222810674-222810696 TGGGGACATCGACAATGGGAAGG + Intergenic
948234028 2:236373948-236373970 TGTGGAGGAAGGCACTGGGGTGG + Intronic
1173181082 20:40806858-40806880 TGTGGACGTTGGCAATGCCACGG + Intergenic
1175102947 20:56593125-56593147 TTTGGTCGTCAGAACTGGGAGGG - Intergenic
1175616665 20:60405551-60405573 TGTGGAGGGCAGCACTGAGAGGG + Intergenic
1175728908 20:61339267-61339289 TGTGGAGGAAGGGACTGGGATGG + Intronic
1175877974 20:62239149-62239171 TGTGCACGTCGTCCCGGGGAGGG + Intronic
1179591462 21:42412111-42412133 TGTGGCCAATGGCACTGGGAAGG + Intronic
1184807067 22:46802191-46802213 TGTGGTTGTAGGCACTGGGGAGG + Intronic
1185384451 22:50525448-50525470 TGCGGACGCCGGGGCTGGGAGGG - Intronic
949515364 3:4802513-4802535 TATGGACGTCAGAAATGGGAAGG + Intronic
952883532 3:37999412-37999434 GGTGGACGACGGCTCTGGGAAGG + Exonic
953369061 3:42371940-42371962 TGTGGAGGTTGGCACAGGAACGG - Intergenic
955331227 3:58049352-58049374 TGTGGCCTTGGGCACTGGGGTGG + Intronic
962392990 3:134988943-134988965 TGTTCACGTCTGCTCTGGGAAGG + Intronic
966901798 3:184492170-184492192 TGGGGGCGTGGGGACTGGGAGGG - Intronic
967234757 3:187373409-187373431 TCTGAAAGTGGGCACTGGGAAGG + Intergenic
967911818 3:194548747-194548769 TGTGTGCATCGGCACTGGGGAGG + Intergenic
967939673 3:194756316-194756338 TGTGGAAGACCGCACAGGGAAGG - Intergenic
968054882 3:195683844-195683866 TGTGGACGTCGGCACTGGGAAGG + Intergenic
968101029 3:195965428-195965450 TGTGGACGTCAGCACTGGGAAGG - Intergenic
968128869 3:196180324-196180346 TCTGGATGTCCACACTGGGAAGG + Intergenic
969496147 4:7527398-7527420 TGTGGTAGTCGGCGCTGTGACGG + Intronic
973194197 4:47420822-47420844 TGTGGATGTCAGCAGTGGTATGG + Intronic
979851892 4:125581866-125581888 TATGGATGTTGGCACTTGGAGGG + Intergenic
982194830 4:152900535-152900557 TATGGGTGTGGGCACTGGGAAGG - Intronic
985218793 4:187681008-187681030 TGTGGAGATAGGCAGTGGGAGGG - Intergenic
985348703 4:189035244-189035266 AGTGGAGGTGGGCACTGGAAGGG - Intergenic
985502054 5:254485-254507 TGTGGACGTTGGCACTGGGAAGG + Exonic
985734964 5:1574181-1574203 TGTGGACGTTGGCACTGGGAAGG - Intergenic
987249861 5:16088236-16088258 TGTGGACGTATGCACAGGAAGGG - Intronic
992400876 5:76410194-76410216 TTTGGATGGCGGCAATGGGAGGG + Intronic
1006419518 6:33924551-33924573 GGTCTTCGTCGGCACTGGGAGGG - Intergenic
1007189319 6:39999858-39999880 TGTGGAGGTCGGCATTGAGCTGG - Intergenic
1015924696 6:138296949-138296971 GGTGGAGGTGAGCACTGGGAAGG + Exonic
1018276658 6:162139480-162139502 TGAGGACGTCGGGTGTGGGAAGG + Intronic
1026452268 7:70539879-70539901 TGTGGGGGTTGGCACAGGGATGG + Intronic
1032718076 7:134527956-134527978 TGTGGGCCTGGGCACTTGGAAGG + Exonic
1032722930 7:134565525-134565547 TGTGGGCCTGGGCACTTGGAGGG + Intronic
1033741917 7:144282639-144282661 TGTGGATGTCAGCAGTGGGGTGG - Intergenic
1033751984 7:144366975-144366997 TGTGGATGTCAGCAGTGGGGTGG + Intronic
1034529187 7:151684810-151684832 TGTGGCTGGGGGCACTGGGATGG - Intronic
1036619136 8:10411910-10411932 TGTGGACACCGCCCCTGGGAAGG + Intronic
1037229261 8:16635464-16635486 TGTAGAAGTCTGCAATGGGAAGG + Intergenic
1037896424 8:22659246-22659268 TGTGGTCATAGGCACTGGAAAGG - Intronic
1038256578 8:25956077-25956099 TGTGTAGGTCTGCACAGGGATGG + Intronic
1043697436 8:83237848-83237870 TGTTTACGTCGACACAGGGAGGG - Intergenic
1049057059 8:140245267-140245289 GGAGGACGTCAGCATTGGGATGG - Intronic
1056891163 9:90494232-90494254 TGGGAACACCGGCACTGGGAGGG + Intergenic
1061165103 9:128917666-128917688 TGGGGAGGTCGCCCCTGGGAGGG + Exonic
1193991155 X:88309027-88309049 TGTGGACGTTGGCCTTGGAAAGG - Intergenic
1194685488 X:96908918-96908940 TGTGTTCTGCGGCACTGGGAGGG + Intronic
1199381686 X:147179756-147179778 TGTGGAAGTAGGGAATGGGAAGG - Intergenic
1199897643 X:152138754-152138776 CGTGGAGGTGGGAACTGGGATGG + Intergenic
1201594018 Y:15647300-15647322 TGTGGTCGTAGGCACTTGGCAGG - Intergenic