ID: 968054883

View in Genome Browser
Species Human (GRCh38)
Location 3:195683853-195683875
Sequence CGGCACTGGGAAGGTCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 3, 2: 1, 3: 17, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968054880_968054883 -10 Left 968054880 3:195683840-195683862 CCTATGTGGACGTCGGCACTGGG 0: 1
1: 3
2: 1
3: 5
4: 46
Right 968054883 3:195683853-195683875 CGGCACTGGGAAGGTCAGTGTGG 0: 1
1: 3
2: 1
3: 17
4: 228
968054873_968054883 24 Left 968054873 3:195683806-195683828 CCCTTTGAGGTGCACTGGAGGAA 0: 1
1: 3
2: 1
3: 9
4: 125
Right 968054883 3:195683853-195683875 CGGCACTGGGAAGGTCAGTGTGG 0: 1
1: 3
2: 1
3: 17
4: 228
968054877_968054883 -4 Left 968054877 3:195683834-195683856 CCCTGTCCTATGTGGACGTCGGC 0: 1
1: 3
2: 0
3: 0
4: 32
Right 968054883 3:195683853-195683875 CGGCACTGGGAAGGTCAGTGTGG 0: 1
1: 3
2: 1
3: 17
4: 228
968054874_968054883 23 Left 968054874 3:195683807-195683829 CCTTTGAGGTGCACTGGAGGAAG 0: 1
1: 3
2: 1
3: 12
4: 151
Right 968054883 3:195683853-195683875 CGGCACTGGGAAGGTCAGTGTGG 0: 1
1: 3
2: 1
3: 17
4: 228
968054878_968054883 -5 Left 968054878 3:195683835-195683857 CCTGTCCTATGTGGACGTCGGCA 0: 1
1: 3
2: 0
3: 1
4: 47
Right 968054883 3:195683853-195683875 CGGCACTGGGAAGGTCAGTGTGG 0: 1
1: 3
2: 1
3: 17
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968054883 Original CRISPR CGGCACTGGGAAGGTCAGTG TGG Intergenic
900117256 1:1033989-1034011 CGGGGCTGGGGAGGTGAGTGAGG - Intronic
900710432 1:4109841-4109863 CGGCACTGAGAAGGGGAGAGGGG - Intergenic
901441314 1:9280193-9280215 CTTCACGGGGATGGTCAGTGAGG + Intergenic
902333250 1:15741217-15741239 CTGCAGTGTGAAGGTCGGTGCGG - Exonic
902878217 1:19353554-19353576 CAGCCCTGGGAGGGTCAGAGGGG - Intronic
903003718 1:20284480-20284502 AGGCACTGGCGTGGTCAGTGAGG + Intergenic
903849585 1:26297834-26297856 TCGAACTGGGCAGGTCAGTGTGG + Intronic
905656968 1:39691593-39691615 CGACTCCGGGAAGGTCAGCGCGG - Exonic
905790293 1:40785825-40785847 CGGCACAGGGAGGGGCAGGGGGG + Intronic
905918219 1:41700513-41700535 GGGCTCTGGGGAGGACAGTGGGG - Intronic
906163730 1:43670175-43670197 AGTCACTTGGAAGGTCATTGAGG + Intronic
906559193 1:46742601-46742623 AGGCACTGCTAAGGTCAGGGAGG + Intergenic
906654825 1:47540476-47540498 CTGGGCTGGGAAGGTCAGTGTGG + Intergenic
907217428 1:52877044-52877066 AGCCACTGAGCAGGTCAGTGGGG - Intronic
908339049 1:63157734-63157756 AGGGACTAGGAAGTTCAGTGAGG + Intergenic
908908404 1:69043025-69043047 AGAGACTGGGAAGGTTAGTGGGG + Intergenic
910920357 1:92339496-92339518 AGGGACTGGGAAGGTCAGTGAGG - Intronic
913328872 1:117650970-117650992 GGGCACTGGGAACGACAGAGGGG - Intergenic
914827795 1:151147605-151147627 AGCCCCTGGGAATGTCAGTGAGG + Intergenic
915320591 1:155053955-155053977 TGGCACTCGGGTGGTCAGTGAGG + Exonic
915524261 1:156466557-156466579 CAACACTGGGATGGTCTGTGGGG - Exonic
915898098 1:159826926-159826948 CTTCTCTGGGAAGGTAAGTGGGG + Exonic
916486910 1:165267812-165267834 CAGTACTGGGGAGGTCAGTGAGG + Intronic
918777859 1:188658699-188658721 AGGGACTGTGAAGGTCATTGTGG + Intergenic
919640163 1:200039011-200039033 CGGTGCTGGGAAGGACAGGGGGG - Intronic
920565570 1:206969981-206970003 CTGCTCTGGGAAGGGCACTGAGG + Intronic
923626374 1:235617033-235617055 CGGCACTGGGCAGGGCACAGTGG - Intronic
1062848957 10:728767-728789 TGGCACAGGGAGGGCCAGTGGGG - Intergenic
1065089752 10:22219987-22220009 CATCTCTGTGAAGGTCAGTGTGG + Intergenic
1066057229 10:31693567-31693589 CGGGAATGGCAAGGACAGTGTGG - Intergenic
1068367439 10:56068731-56068753 AGGCACGGGGAGGGTCACTGTGG + Intergenic
1070464260 10:76703772-76703794 CTGCCCTGGGAGGGTCAGAGGGG + Intergenic
1070862670 10:79685098-79685120 GCGCACCGGGAAGCTCAGTGAGG - Intergenic
1071530426 10:86387164-86387186 CAGCACTGGGAAGATGTGTGAGG + Intergenic
1072722472 10:97789333-97789355 CTGCGCTGGGAAGGGCAGGGGGG + Intergenic
1073453917 10:103625271-103625293 CTGCACCAGGAAGGTCAGAGCGG - Intronic
1074313598 10:112343024-112343046 GGGCCCTGGGAAGGCCAGTTTGG - Intergenic
1075764911 10:124885544-124885566 GGGGCCTGGGAAGGTCAGAGGGG - Intergenic
1076168349 10:128300325-128300347 AGCCAATGGGAAGGTCAGAGAGG + Intergenic
1076994494 11:291471-291493 GGGGACTGGGAAGGCCTGTGGGG + Intronic
1077124067 11:924840-924862 TGGCTCTGGGAAGGACAGTGAGG + Intergenic
1078014955 11:7605014-7605036 CAGAAATGGGAAGGTCAGTCAGG + Intronic
1080642761 11:34167283-34167305 CAGCACAGCGAATGTCAGTGAGG + Exonic
1080642915 11:34168153-34168175 GGGCATGGGGAAGGTGAGTGGGG + Intronic
1081239636 11:40688648-40688670 CGTCAGTGGAAAGGTCAGAGGGG + Intronic
1084160924 11:67349674-67349696 AGGCACTGAGGAGGCCAGTGAGG - Intronic
1086788608 11:91005310-91005332 CCACACTGGGAAGCTCTGTGTGG + Intergenic
1088507661 11:110542082-110542104 CTGAAGTGGGGAGGTCAGTGGGG + Intergenic
1090670773 11:128943652-128943674 CGGGAGTGGGAATCTCAGTGGGG - Intergenic
1092132027 12:6119402-6119424 GAGCCCTGGGGAGGTCAGTGTGG - Intronic
1092162527 12:6323942-6323964 CGGCACTGGGGAGTTCTGGGAGG + Intronic
1092535077 12:9379486-9379508 GAGCAGTGGGAAGGGCAGTGAGG + Intergenic
1094030940 12:26010525-26010547 CGGCCCTGGGGAGGGCACTGTGG + Intronic
1094497958 12:31000976-31000998 AGCCACAGGGAAGGGCAGTGGGG - Intergenic
1094557637 12:31517716-31517738 GGGATCTGGGAAGGTCAGGGAGG + Intronic
1095837269 12:46652455-46652477 CATGACTGAGAAGGTCAGTGTGG + Intergenic
1096370884 12:51068021-51068043 CTGCTCTGGGATGGTCACTGAGG - Intronic
1096555316 12:52400218-52400240 CTGCTCTGGGAAGGTCAGAACGG - Intronic
1096694285 12:53338937-53338959 GGGCACTGGGAAGGAGACTGGGG - Intronic
1097929539 12:65169317-65169339 CGGCACTTGGAAGGGCAGGGCGG + Intergenic
1102123157 12:110458901-110458923 AGGCACTGAAAAGGCCAGTGTGG - Intronic
1102576157 12:113857420-113857442 TGGCACAGGGAAGGCCAGTGTGG + Intronic
1106990488 13:35413891-35413913 CAACACTAGGAAGGTGAGTGTGG - Intronic
1109633615 13:65085254-65085276 TGGCACTGGGAAATGCAGTGTGG + Intergenic
1110090588 13:71442186-71442208 AGAGACTGGGAAGGTTAGTGAGG - Intronic
1113438502 13:110310978-110311000 AGGCCCTGGGAAGCTCGGTGTGG - Intronic
1113625918 13:111846288-111846310 CGGCCCCAGGAAGGACAGTGAGG + Intergenic
1114650941 14:24284344-24284366 CAGCACTGGGCAGGGCAGGGTGG - Intergenic
1115673537 14:35643878-35643900 AGAGACTGGGAAGGGCAGTGGGG + Intronic
1115732646 14:36287912-36287934 AGGCAGTGAGAAGGCCAGTGTGG + Intergenic
1118840419 14:69505824-69505846 CGGCTCTGGGAAGATGAGTCAGG - Intronic
1121088851 14:91167469-91167491 AGGCACTGTGAAGGTCCCTGAGG - Intronic
1122871650 14:104641479-104641501 GGCCACTGGGAAGGTCCTTGTGG - Intergenic
1125969936 15:43903619-43903641 AGGCACAGGGAAGGTAAGTTAGG + Intronic
1127704958 15:61537345-61537367 GGGCACTAGGTAGGTCAGGGAGG + Intergenic
1128614411 15:69098256-69098278 CTGGACTGTGAAGGCCAGTGTGG + Intergenic
1128777154 15:70329272-70329294 CAGCAATGGGAAGCTCAGAGAGG + Intergenic
1129244847 15:74272818-74272840 CGGGATAGGGAAGGACAGTGGGG - Exonic
1129769513 15:78194188-78194210 AGGCCCTGGGAGGGGCAGTGAGG - Intronic
1131116161 15:89797334-89797356 AGGCACTGAGGAGGTGAGTGAGG - Intronic
1133334919 16:5000784-5000806 CGGGCCTGGGAAGGACTGTGTGG + Intronic
1136682757 16:31977625-31977647 AGGCTCGGGGAAGGTAAGTGGGG - Intergenic
1136783395 16:32921191-32921213 AGGCTCGGGGAAGGTAAGTGGGG - Intergenic
1136886392 16:33932658-33932680 AGGCTCGGGGAAGGTAAGTGGGG + Intergenic
1137874429 16:51982128-51982150 CGGCACTGGGAAGAGGAGGGGGG + Intergenic
1138527602 16:57618026-57618048 TGGGACTGGGAATGCCAGTGGGG + Intronic
1140487441 16:75304831-75304853 TGTCACTGGGAAGGCCACTGCGG - Intronic
1141749022 16:85945990-85946012 TGGCACTGGGCAGGTGGGTGGGG + Intergenic
1142065550 16:88060321-88060343 CTCCACTTGGATGGTCAGTGTGG + Intronic
1203086046 16_KI270728v1_random:1185175-1185197 AGGCTCGGGGAAGGTAAGTGGGG - Intergenic
1142903123 17:3025902-3025924 CGGCACGGTGAGGGGCAGTGGGG - Intronic
1143439410 17:6957478-6957500 CGGCCCTGGGAGGTTCAATGTGG + Intronic
1143451382 17:7038773-7038795 CAGCACGGAGAAGGCCAGTGGGG - Exonic
1144771506 17:17762123-17762145 CTGCACTGGTAAGCTCCGTGAGG - Intronic
1145125075 17:20293441-20293463 CTGCCCTGGGAAGGTCATTTAGG - Intronic
1146465029 17:33079626-33079648 GAGCACTGGGGAGGCCAGTGAGG + Intronic
1146589259 17:34114377-34114399 TGGCTCTGGGAAGGTCTGTGAGG + Intronic
1146652017 17:34612858-34612880 CGTCACTGGGGGGGGCAGTGGGG + Intronic
1147143664 17:38473384-38473406 AGGCTCAGGGAAGGTAAGTGGGG - Intronic
1152075537 17:78157464-78157486 CTGCATTGGGAAGGTCGCTGAGG - Intronic
1152261540 17:79269913-79269935 AGGCACAGGGAGGGGCAGTGTGG - Intronic
1152572022 17:81125075-81125097 GGGCAGGGGGAGGGTCAGTGGGG + Intronic
1153783602 18:8515296-8515318 CCACAATGGGAGGGTCAGTGAGG - Intergenic
1158537182 18:58318858-58318880 CGTCCCTGGGAAAGGCAGTGGGG + Intronic
1159051825 18:63427391-63427413 AGAAACTAGGAAGGTCAGTGGGG + Intergenic
1160538485 18:79607798-79607820 CAGCAGTGGGGAGGGCAGTGGGG - Intergenic
1160767431 19:814657-814679 AGGGCCTGGGAAGGGCAGTGAGG + Exonic
1161551678 19:4916507-4916529 CGGCACTTCGGGGGTCAGTGAGG - Intronic
1162777223 19:12987212-12987234 TGGCTCTGGGAAGGCCTGTGTGG + Intergenic
1163686748 19:18716104-18716126 GGGCACTGGGCAGGGCAGCGGGG - Intronic
1164681596 19:30137529-30137551 CGGCATTGGAGGGGTCAGTGTGG + Intergenic
1165095926 19:33409988-33410010 CGGGGCTGGGAGGGTCAGAGCGG - Intronic
1165935270 19:39385077-39385099 CGGCACTGGGAGAGGAAGTGGGG - Intronic
1166705019 19:44903752-44903774 CGGCTGGGGGAAGGTCAGGGCGG - Intergenic
1168348623 19:55662899-55662921 AGGTTCTGGGAAGGTCAGTGTGG - Intronic
925515759 2:4679157-4679179 AGTCACTGGGAAGGTCAGCCTGG + Intergenic
925995912 2:9292959-9292981 CGGCTCTTGACAGGTCAGTGTGG - Intronic
927946479 2:27137893-27137915 GGGGACTGGCAAGGTGAGTGGGG + Exonic
928926238 2:36582475-36582497 CGGTATTAGGCAGGTCAGTGAGG + Intronic
931172123 2:59814583-59814605 TGCCTCTGGGAAGGACAGTGGGG + Intergenic
931322385 2:61183607-61183629 AGGCACTGCCAAGGTCAGGGAGG + Intronic
932567192 2:72917546-72917568 CGGGGCTGGGCAGGGCAGTGCGG + Exonic
933446650 2:82388200-82388222 AGAGACTGGGAAGGTTAGTGAGG + Intergenic
934922375 2:98355990-98356012 CGGCTGTAGGAATGTCAGTGTGG + Intronic
935499124 2:103816785-103816807 CGGCTCTGGGAAGGCAACTGAGG - Intergenic
937954634 2:127415222-127415244 CAGGCCTGGGAAGGTCAGGGAGG - Intergenic
938408909 2:131047720-131047742 CAGCACTGCCAAGGTCACTGGGG + Intergenic
943941669 2:194006168-194006190 CTGCATTAGGAAGGTCACTGTGG + Intergenic
944174468 2:196814649-196814671 GGGCACTGGGAATGTGAGGGTGG - Intergenic
945726792 2:213479715-213479737 CAGCACTGGGAAGACAAGTGTGG - Intronic
947610909 2:231524669-231524691 AGGAACTGGGAAGGACAGTGAGG + Exonic
948385268 2:237576903-237576925 CGGCAGAGGGAAGGGCAGGGCGG - Intronic
949048969 2:241887017-241887039 CCGCACCGGGAAGGGCAGGGAGG - Intergenic
1168789627 20:567574-567596 CGGGAATGGGAAGGTAAGGGAGG + Intergenic
1175741864 20:61425330-61425352 CGACACTAGGACGTTCAGTGTGG + Intronic
1175940916 20:62537228-62537250 CAGCCCTGGGAAGGTCACTCAGG + Intergenic
1176030351 20:63008513-63008535 TGGCACAGGGAAGGGCAGTGAGG + Intergenic
1176250924 20:64119544-64119566 AGGCTCTGGGAAGCTCCGTGCGG - Intergenic
1178723328 21:35029464-35029486 AGGCATTGGGCAGGTGAGTGGGG + Intronic
1179303493 21:40134078-40134100 TGGCACAGGGACAGTCAGTGGGG - Intronic
1179444822 21:41423917-41423939 CAGGACTCGGAAGGGCAGTGAGG - Intronic
1180174871 21:46082610-46082632 CGGGACTGGGAGGGTCTCTGGGG - Intergenic
1180848728 22:18999433-18999455 AGGCAGAGGGAAGGGCAGTGTGG - Intergenic
1180956434 22:19743410-19743432 CGGCACTGGGGCGGTCTGGGTGG + Intergenic
1181002175 22:19992959-19992981 CGGCAATGAGAAGGTCATCGTGG - Intronic
1181304318 22:21906129-21906151 AGGCACTGGAGATGTCAGTGTGG - Intergenic
1181439518 22:22928599-22928621 GGTCACTGTGAGGGTCAGTGAGG - Intergenic
1184396510 22:44245086-44245108 CAGCACTGGGACAGTCAGAGAGG - Exonic
1185119442 22:48957346-48957368 GGCCACTGTGAGGGTCAGTGTGG + Intergenic
1185288914 22:50014482-50014504 AGGCCCAGGGAAGGACAGTGGGG + Intergenic
949667446 3:6356522-6356544 GGGCAGAGGGAAGGACAGTGTGG + Intergenic
949979457 3:9492616-9492638 CGGCACTGGAAAGCTCCGTGAGG - Intergenic
950019828 3:9779465-9779487 CGACACTGTGGAGGGCAGTGTGG + Intronic
950471625 3:13189945-13189967 CGGCTCTGGGAGGGTCAGGGAGG - Intergenic
951599115 3:24353560-24353582 CTGAACTGTGCAGGTCAGTGTGG + Intronic
952659743 3:35831282-35831304 CTGCCCTTGGAAGGTCACTGTGG - Intergenic
953356493 3:42260555-42260577 CAGCACTGGGAAAGTGAGTGAGG - Intronic
953451837 3:43012546-43012568 AGTCACAGGGAAGGGCAGTGTGG + Intronic
953451855 3:43012654-43012676 AGTCACAGGGAAGGGCAGTGTGG + Intronic
953451873 3:43012762-43012784 AGTCACAGGGAAGGGCAGTGTGG + Intronic
954369250 3:50161614-50161636 CGGAACAGGGAAGGTCATTCAGG - Intronic
956680606 3:71775945-71775967 CGGAGCTGGGCAGGGCAGTGAGG - Intronic
961474852 3:127140234-127140256 AGGCACTGGCAAGGGCAGTTGGG + Intergenic
965390377 3:168096062-168096084 CGGCACTGGGAGGGAAGGTGCGG - Intergenic
967946771 3:194810331-194810353 CGGCACTGGGCAGACCAGAGAGG - Intergenic
968054883 3:195683853-195683875 CGGCACTGGGAAGGTCAGTGTGG + Intergenic
968088113 3:195883300-195883322 CCGCTCTGGGCAGGTGAGTGTGG - Exonic
968101028 3:195965419-195965441 CAGCACTGGGAAGGTCAGTGTGG - Intergenic
968356912 3:198115646-198115668 TGGAGCTGGGAAGGGCAGTGTGG + Intergenic
968521672 4:1037145-1037167 GGGCCCTGGGAGGGGCAGTGGGG + Intergenic
969401638 4:6959530-6959552 CGCCTCTGGGAAGCACAGTGTGG + Intronic
971719079 4:30221356-30221378 AGTCATTGGCAAGGTCAGTGAGG + Intergenic
972802192 4:42488671-42488693 GGGCACTGGGAAGGAAAGTTAGG - Intronic
973047348 4:45551500-45551522 CAGCACTGGGAAGGTGCTTGGGG - Intergenic
974665612 4:64957240-64957262 AGGCACTACGAAGGTGAGTGTGG + Intergenic
975198603 4:71556965-71556987 CGTCACTGGCAAGGTCAATTCGG + Intronic
977071063 4:92388413-92388435 AGGCAGTGGGAAGGTAAATGAGG - Intronic
978497175 4:109372410-109372432 GGGCAGTGGCAAGGTCAGGGAGG + Intergenic
979224978 4:118274354-118274376 TTACACTTGGAAGGTCAGTGTGG + Intergenic
984784099 4:183552462-183552484 CGTCACTAGTAAGGTCAGAGGGG + Intergenic
985269186 4:188178165-188178187 AGACACTGGGAAGATCAGTGCGG + Intergenic
985502055 5:254494-254516 TGGCACTGGGAAGGTCAGTGTGG + Exonic
985734963 5:1574172-1574194 TGGCACTGGGAAGGTCAGTGTGG - Intergenic
986019692 5:3789942-3789964 CGGGACTGGGAAGTGCAGTTGGG + Intergenic
990579848 5:57157372-57157394 CAGCATTGGGTAGGTCTGTGAGG - Intergenic
994905212 5:105832277-105832299 TGGAAATGGGAAAGTCAGTGAGG - Intergenic
995596989 5:113757845-113757867 CTGCACAGTGAAAGTCAGTGAGG + Intergenic
997592918 5:135086609-135086631 CGGTGCAGGGAAGGTCAGCGTGG + Intronic
997597333 5:135115880-135115902 TGGCTCTGGGAAATTCAGTGTGG + Intronic
997865613 5:137460180-137460202 AGGCAGTGGGATGGTCAGAGTGG + Intronic
997884026 5:137614880-137614902 CAACACTGGGAAGGACACTGGGG + Intergenic
998250099 5:140546895-140546917 CAGGAAGGGGAAGGTCAGTGAGG - Intronic
998252214 5:140560958-140560980 AGGCAAGGGGAAGGTGAGTGAGG - Intronic
999281478 5:150369307-150369329 AGGCCCTGGGAAGGGCTGTGAGG - Intronic
1001629689 5:173165468-173165490 AGGACCTGGGAAGGGCAGTGTGG + Intergenic
1003615460 6:7651329-7651351 TGCCACCAGGAAGGTCAGTGTGG + Intergenic
1004593238 6:17073821-17073843 AGCCACTGGGAAGGTCAGACTGG + Intergenic
1006024095 6:31136472-31136494 CGGCTCTGGGAAGGGCACTCTGG + Intronic
1006166974 6:32070842-32070864 GGGCACTCGGCAGGTCAGGGAGG + Intronic
1006981497 6:38151587-38151609 CTGCACTGGGTAGGTGAGAGAGG - Intronic
1008690624 6:53974725-53974747 CAGCACTTGGAAGTGCAGTGTGG - Intronic
1010557456 6:77301662-77301684 CGAGACTGGGAAGGATAGTGGGG - Intergenic
1011982299 6:93395890-93395912 GGCCACTGGGAAGCTCAGAGAGG - Intronic
1016070812 6:139736551-139736573 CGGAACTTGGAAGTTCACTGTGG - Intergenic
1017888760 6:158622124-158622146 AGGCGCTGGGGAGGTCAGAGTGG - Intronic
1018093888 6:160367957-160367979 GGCCAGTGGGAAGGGCAGTGGGG - Intronic
1020169503 7:5833999-5834021 CGGCTGTGGGAAGGACAGGGTGG + Intergenic
1022092502 7:27116870-27116892 CGGCACTGGGGAGGGCAGAAGGG + Intronic
1022127934 7:27376029-27376051 AGGCTCTGGAAACGTCAGTGAGG - Intergenic
1024015589 7:45311660-45311682 GGGCATTGGGGAGGTGAGTGGGG + Intergenic
1024029054 7:45441242-45441264 AGGGGCTGGGAAGGGCAGTGGGG + Intergenic
1025254376 7:57373502-57373524 CAGCACTGTGAGGGTGAGTGTGG + Intergenic
1026474534 7:70723412-70723434 GGGCACTTGGAAGCTCAGAGAGG + Intronic
1026658156 7:72275449-72275471 GGGCTCTGGGCAGGACAGTGCGG - Intronic
1029409903 7:100402412-100402434 TGGCACTGAGATGGGCAGTGAGG + Intronic
1033793120 7:144816422-144816444 TGGCCCTTGGAAGGTCAGTTTGG - Intronic
1034392970 7:150800584-150800606 CGGCCCTGGGAAAGCCCGTGGGG - Exonic
1037950308 8:23015152-23015174 TGGCACTGTGAAGGCCACTGTGG - Intronic
1040758349 8:50808158-50808180 AGGCACAGGGCAGGTGAGTGTGG + Intergenic
1041396464 8:57396675-57396697 CAGCACTGGGCACGTCTGTGAGG - Intergenic
1042627143 8:70770678-70770700 AGCCACTGGGAAGGTCAGGCTGG - Intronic
1042804543 8:72757271-72757293 TGGCAATGTGAAGGTCAATGGGG + Intronic
1043484168 8:80682617-80682639 TGGCATTGGCACGGTCAGTGTGG + Intronic
1044065008 8:87688317-87688339 AGGAACGGGGAAGGGCAGTGGGG - Intergenic
1044519105 8:93177231-93177253 CGAGACTGGAAAGGTGAGTGGGG + Intergenic
1047778377 8:128092097-128092119 CTGCACTGGGAGGGTCAGCTGGG - Intergenic
1048820127 8:138372818-138372840 CAGCACAGGGCAGGTCAGTAAGG - Intronic
1049600381 8:143504774-143504796 CGGCAGTGGGGAGTACAGTGAGG - Intronic
1049696186 8:143985402-143985424 CAGCAGTGGCAAGGTGAGTGGGG - Exonic
1050036542 9:1442181-1442203 ATGCAATGAGAAGGTCAGTGAGG - Intergenic
1051149761 9:14067606-14067628 AGGCACTGGGAAGATCACTGGGG + Intergenic
1051872763 9:21757853-21757875 AGGCACTGGGAAGTTAAGAGAGG + Intergenic
1052130222 9:24835688-24835710 AGGCGCCTGGAAGGTCAGTGAGG + Intergenic
1057255678 9:93545248-93545270 CTGCACTGGGAGGGCCAGGGCGG - Intronic
1058998349 9:110321898-110321920 CAGCACTGTCAGGGTCAGTGAGG - Intronic
1060506037 9:124199101-124199123 AGGCACAGGAAAGGTCTGTGTGG - Intergenic
1061151922 9:128833689-128833711 CGGCCTTGGGAAGCTCTGTGAGG + Intronic
1061406162 9:130394068-130394090 GGGCAATGGGAAGGACAGTGAGG + Intronic
1061494007 9:130961381-130961403 GGGCACTGGGAGTGTCAGTGGGG + Intergenic
1061635189 9:131903474-131903496 CGGCACAGGGAAAGGCAGAGTGG + Intronic
1062535483 9:137019371-137019393 AGCCACTGGGGAGGTGAGTGGGG - Intronic
1203783984 EBV:116837-116859 CCGTCCGGGGAAGGTCAGTGGGG + Intergenic
1186095903 X:6101660-6101682 AGGCACTGGAAAGGGTAGTGGGG + Intronic
1186105896 X:6205341-6205363 AGGCACTGGGCTGCTCAGTGAGG - Intronic
1186771040 X:12818450-12818472 AGGCAGTGGGAAGGGCAGTTAGG - Intronic
1189290391 X:39881016-39881038 AGGCTCTGAGAAGCTCAGTGTGG - Intergenic
1192529108 X:71871013-71871035 AGGCCCTGGGAGGGCCAGTGTGG + Intergenic
1196703393 X:118695930-118695952 CGGCACTGGGGAGGTCAAGGTGG + Intergenic
1198735893 X:139784795-139784817 GGGAACCAGGAAGGTCAGTGAGG + Intronic
1201068354 Y:10121153-10121175 CGAGACTGGGAAGGGCAGGGAGG + Intergenic