ID: 968055511

View in Genome Browser
Species Human (GRCh38)
Location 3:195688586-195688608
Sequence TGGGGGCCTCAGCACTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968055505_968055511 23 Left 968055505 3:195688540-195688562 CCAGAGGACAACACATCACACAC 0: 1
1: 3
2: 0
3: 13
4: 150
Right 968055511 3:195688586-195688608 TGGGGGCCTCAGCACTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968055511 Original CRISPR TGGGGGCCTCAGCACTAGGA AGG Intergenic
No off target data available for this crispr