ID: 968057742

View in Genome Browser
Species Human (GRCh38)
Location 3:195705595-195705617
Sequence CAGTTTAGCCCTAAAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968057738_968057742 -7 Left 968057738 3:195705579-195705601 CCTAAACAAAGCCCTCCAGTTTA No data
Right 968057742 3:195705595-195705617 CAGTTTAGCCCTAAAGAGCCAGG No data
968057737_968057742 -6 Left 968057737 3:195705578-195705600 CCCTAAACAAAGCCCTCCAGTTT No data
Right 968057742 3:195705595-195705617 CAGTTTAGCCCTAAAGAGCCAGG No data
968057736_968057742 7 Left 968057736 3:195705565-195705587 CCTTCAAGTTTATCCCTAAACAA No data
Right 968057742 3:195705595-195705617 CAGTTTAGCCCTAAAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968057742 Original CRISPR CAGTTTAGCCCTAAAGAGCC AGG Intergenic
No off target data available for this crispr