ID: 968058633

View in Genome Browser
Species Human (GRCh38)
Location 3:195712016-195712038
Sequence CAGACTTAAGGGCAGTAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968058633_968058638 9 Left 968058633 3:195712016-195712038 CCACATTACTGCCCTTAAGTCTG No data
Right 968058638 3:195712048-195712070 TGGTCTGAGCCCCGTAGTCCAGG No data
968058633_968058642 22 Left 968058633 3:195712016-195712038 CCACATTACTGCCCTTAAGTCTG No data
Right 968058642 3:195712061-195712083 GTAGTCCAGGCCTCATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968058633 Original CRISPR CAGACTTAAGGGCAGTAATG TGG (reversed) Intergenic
No off target data available for this crispr