ID: 968058638

View in Genome Browser
Species Human (GRCh38)
Location 3:195712048-195712070
Sequence TGGTCTGAGCCCCGTAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968058635_968058638 -2 Left 968058635 3:195712027-195712049 CCCTTAAGTCTGGAAATATTCTG No data
Right 968058638 3:195712048-195712070 TGGTCTGAGCCCCGTAGTCCAGG No data
968058631_968058638 21 Left 968058631 3:195712004-195712026 CCTTCCTGGGCTCCACATTACTG No data
Right 968058638 3:195712048-195712070 TGGTCTGAGCCCCGTAGTCCAGG No data
968058632_968058638 17 Left 968058632 3:195712008-195712030 CCTGGGCTCCACATTACTGCCCT No data
Right 968058638 3:195712048-195712070 TGGTCTGAGCCCCGTAGTCCAGG No data
968058633_968058638 9 Left 968058633 3:195712016-195712038 CCACATTACTGCCCTTAAGTCTG No data
Right 968058638 3:195712048-195712070 TGGTCTGAGCCCCGTAGTCCAGG No data
968058636_968058638 -3 Left 968058636 3:195712028-195712050 CCTTAAGTCTGGAAATATTCTGG No data
Right 968058638 3:195712048-195712070 TGGTCTGAGCCCCGTAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968058638 Original CRISPR TGGTCTGAGCCCCGTAGTCC AGG Intergenic