ID: 968058642

View in Genome Browser
Species Human (GRCh38)
Location 3:195712061-195712083
Sequence GTAGTCCAGGCCTCATGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968058635_968058642 11 Left 968058635 3:195712027-195712049 CCCTTAAGTCTGGAAATATTCTG No data
Right 968058642 3:195712061-195712083 GTAGTCCAGGCCTCATGTTCAGG No data
968058633_968058642 22 Left 968058633 3:195712016-195712038 CCACATTACTGCCCTTAAGTCTG No data
Right 968058642 3:195712061-195712083 GTAGTCCAGGCCTCATGTTCAGG No data
968058636_968058642 10 Left 968058636 3:195712028-195712050 CCTTAAGTCTGGAAATATTCTGG No data
Right 968058642 3:195712061-195712083 GTAGTCCAGGCCTCATGTTCAGG No data
968058632_968058642 30 Left 968058632 3:195712008-195712030 CCTGGGCTCCACATTACTGCCCT No data
Right 968058642 3:195712061-195712083 GTAGTCCAGGCCTCATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968058642 Original CRISPR GTAGTCCAGGCCTCATGTTC AGG Intergenic