ID: 968060246

View in Genome Browser
Species Human (GRCh38)
Location 3:195722322-195722344
Sequence AGCACAGGCAGGAGGCCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 2, 1: 0, 2: 4, 3: 49, 4: 426}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968060246_968060256 28 Left 968060246 3:195722322-195722344 CCCCGTGGCCTCCTGCCTGTGCT 0: 2
1: 0
2: 4
3: 49
4: 426
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060246_968060252 -10 Left 968060246 3:195722322-195722344 CCCCGTGGCCTCCTGCCTGTGCT 0: 2
1: 0
2: 4
3: 49
4: 426
Right 968060252 3:195722335-195722357 TGCCTGTGCTCACCGTGGCCTGG 0: 2
1: 0
2: 2
3: 22
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968060246 Original CRISPR AGCACAGGCAGGAGGCCACG GGG (reversed) Intronic